Erinaceus_europaeus Locus Mono:193:SNORD31
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:193:SNORD31
Erinaceus_europaeus
Mono:193:SNORD31
scaffold_345429
SNORD31
1001..1069
2069
AAGTTCCCCTAAACTGAGGGTGGCGTGGGGGTTTTCCGGTGTCGCATGAGCACATGTTT
CAATGTGAAAGAACTCGTTTCAAGCACCCATTCTCCACCTGTAGGGGGAAAGATTCTTGA
GTGGTGAAGCAGGGCTGCAGGTGTCTAGCTTTCTCTCTCCTCTCAATTTCTCTCTGTCCT
ATCGAAAAAAAAAATTGAAAAAATGGCCACAGGAGCAGTGGATTCCTAGTGCAGCCACTG
AGCCCCAGGGATAACTAACCCTGGAAGCAAAAACAAAACAAAACAAAAACCATAAGAGTA
ACAAAGAGAGTCAGGCGTAGGCACCGGGTTAAGCGAATTAAAAAAAATTTTAATTTATTT
TTCCTTTGTGTTGCCCTTATTGTTTTATTGTTGTTGTAGTTATTATTACTGATTTTGTCA
TTGCTGGATAAGACAGAGAGAAATGGAGAGAGGACGGGAAGACAGAGGGGGAGAGAAAGA
TAAGACACCTGTAGACCTGGCCTGTGAAGTGACCCCTCTGCAGGTGGGGAGGCGGGGGCT
GGAACTGGGATCCTTAAGCCAGTCCTTGCGCTTTGTGTCACGTGCGCTTAACCCGCTGCC
CTACTGCCCGACGCCCCCCCCCATGTAATTTTTTTTACTGTGATCCAAGAAAAAGACTGA
AGTTGAATCCACCACAAGTGAAACTATACACACTGATTCTCCAATTTATATGTACTATAA
AAGAAACAAAAGTTAGGAAACCTCTCAAAAATATTCAGGTGAAGTATAGGACTAGCCATA
TTAAATATGAAAATATACTACTAAGACATATTACATGACTGAAGCCTGAATGGAACGGTC
AGAAAACAAAGTCTAGAAGTAGACCACATCCACAAAAGAATGTGTTAGTGCAAGACAGAT
CAAACAAACAACAGTGGGATAGATAACTAAGTAATCCTATCTCACATCTTATCACTGCGC
CCATATGCACAAAGAAGAAAATCTAGACTGACCAATGATTTCAAACTAATGATGAATTCA
CTACTGCCCCAGTTTAATCACTGTGACTGATAGGTGTTTTCTGAGCTGTGAGCTTTCCTG
GGAAAAAATTTTTAAAAAATTAAAAAGGAGAAATCTACTTTTTACATTTCTCTGGAGTTA
TTTAGGAAAAATAACAAAACAAAATAAGACACACCAGAAACGACTAGCTTTCAGAAAATT
TACATGTTACCCCTCTGCATCACTGATGACACTAAAGAAACAGTGTAGAAACTGAAACTG
GCGAGGAGACAGAACCCTTAAGACAAGCTGGAAACCCTCTATGTAGCTTCATTTTCTGTT
TTGGCACCGAGGTAGCTAATTGAAGATAAAAGCAGAAAAGATGAGATGACCTTATGCAAA
TAACAGCCTTTAGCATTCTCTACATGCATAACACACATTTGTCATAGGGCACAAACTCAT
GCGAGGCACACACTATCCAAAACAAGTCATTCCATGGCTAAGCCTCTCCAAAAATCTGAC
TGAGACCAAATGGTGTTAAAATTCCTGCAGTTAGTAGGTGTATCAGGCAAACTGAGAAAC
AGTGATTAAAAAATAACAATGGGCCAGAGAAATAGCACAGTGAATCACAAAACAAACTTT
CATGCCTCAGGTTTGGAGGCCCCAGGTTCAATCCCCACTACTACCACGAGCCAGAGCTGA
GCAGCGCTTTGATAAAAAGGAAATAACATCATTTGTAGTCTGTGAAAATCTGAAGATAAG
ATTCAGGGAAGTTATGACTAGATGCATACTGTTTAGGGAAAAAAATAAAAAGATTACTTT
TCTAAATTCCAAGGAAATTATTTTCATAATCTCATTTCAATTACTTGACTAATGAAAAGA
GTAAAATTATGAGGAATCTTGCATGGACAAGTGTTATGGATTGGTCCAAATGTATCAGCT
ATTTTCATGGATCTAGACTATGTTGAAAACTCTACCCCATGTGTAGCTGTGGGTCAGTGA
CTGTAAGGAACATGTCGGTAAGAGACGTGACTGAGCTGAGAGACTACTCCCCACTACTAA
CAACACAGAACCTGCTCAGAGGCCTCCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved