Erinaceus_europaeus Locus Mono:10:SNORA1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:10:SNORA1
Erinaceus_europaeus
Mono:10:SNORA1
scaffold_297896
SNORA1
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
CCCTTAGATCCTGCAATTCCTCTCCTGGGGATATAGCCTAAGGAATCAAACACACCCATC
CAAAAATATCTGTGTATACCTATACCTATGTTCATAGCAGCACAATTTGTAAATGCCAAA
ACCTGGAATCAACCCAGGAGTCCAACAACAGATGTGTGGCTCAGAAAGTTGTGATATATA
TATAATGAAATACTACTCAGCTATTAAAAATGGTGATTTCTAGCCTCATTCTAGATAAAA
ATGGGCACTGTTGATTTTGGTGTTCAGAAATAGATATGGCTACATTGATACAGGTTAAGC
TTCCACCAAAGCATCTATTGCACTGGTGACAATGAAGCCTGTAAGATGTTTAAAAAAAAA
ATGGTGATTTCACCATTTTCAGCCCATCTTGGATGGAGCTTGAAGAAATCATGTGAAGTG
AAATAAGTCAGAAACAGAAGGATGAATATGGGATGATCTCACTCACAGGCAGAAGTTGAA
AAATAAGATCAGAAGAGAAAACACTAAGCAGAACTTGGACTGGAGTTGGTGTACTGCACC
AAAGTAAAAGACTCTGGTGTGCGTGGGTCGGGGGGAGAGTACAGGTCCTGGAAAAGGATG
ACAGAGGACCTACTGGGGGTTGAATTGTTACGTGGAAAACTGAAAAATGTTATGAACGTA
CAAACTATTGTATTTACTGTCGACTGTAAAGCATTAATCCCCCAATAAAGAAATAAATAA
AAAAGACTGGGGTAGGGGGGAGGTTCAGGTCCTAGAAAAGGATGGCAGAGGACCTAGTGG
GGGTTGTATTGTTATGTGGAAAACTGGGAAATGTTATGCATGTACAAACTATTGTATTTA
GTGTCAACTATAAAACATTAATCCCCCCAATAAAGAAATTAAAAAAAAAAGACTCTGGGG
TGGGTGGGTGTGGGGGGAGAAGGTTCAGGTCCTGCAACATGATGGAAGAAGACCTAGTGG
GGATTGTATTGTTATGTGGAAACTGGGAAATGTTCTGCATGTACAAACTATTGTATTTAC
TGTATTTATTGTATTTACTGTAAAACATCAATCCCCCAGTTAAAAAAAACTCTCATGCCT
AAGAAATGTGTGATGAGAAAATGGCTGGGAAAAGGACCTAAACTGGATGTGAGACTGTTT
TGCAGACACCCCTCATAGTGAGATGAGAAATGCTACCCATGTGTCAACTACTGTAGACCA
TTACCACCCTTGCCCCCATAAAATGGTTTTTAAAAATGATGGATGGATTGGGAAAAAAAA
ACAACTAGAGAATAGGTAGTCAGATTATGAAAGATCCCACAGACCAGCTAAGAAATAGAG
TCAGCCTATTGAACAGTATTTGAAGGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved