Erinaceus_europaeus Locus Mono:458:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:458:SNORA70
Erinaceus_europaeus
Mono:458:SNORA70
GeneScaffold_1108
SNORA70
1001..1115
2115
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTTTTTTATTTATAAAAAAGCAAACCACTG
ACAAACCCATAGGATCCCCTCTCTCCATTGTTACTGGTCATCTCTATCAGGAACCACCAA
AAGAGACCACTTTGTGAGCCCCCATAGGACCTTGCCCTCAACTTGGATCAACAACGGTAG
AGAATGTTTCATCCTCTGAAAGGAGGCTGGACAACATAGTCTATGCTACACCTGAGGAAG
ATGGGTCCTGAAATTGGGGCAACTTGGAACGTTCCTACTCATGACCACAGAATGTGAGCT
CAGATCTAAAGGGATGCAGAGGTCACATAGACTCCTAAGCTGAATATGGGCCCCAGATCA
CATCAAATCGATGGGGTTTACAGTCAAAAATATTTATATACTTTCCCCTTATTTGGGAGC
TATTCTCTTCCTAGATCCAGCTTTCTGGACCTTTTTCCAGCCATGACATCATCTCCCCAG
ACAATAACTTGGATCCACCTGCATATCAGATGTCAGGCTCAGGGAAAAAAAAAAAAAGAG
TTGTAATTTTCATCTCATTCTTTCCCTACTCTAAAACATTTGCCCCAAATATGTGGGAAA
AATGAAATGCTTCTCTTTTCCCATTGTATTCCTCTTGGGAAGTTGCAAAAAGGCTTGCTG
CAAGAATAAGAGAAGAAAAGCATTAGTGCATCTTGCTTTTTAGGTTGCTAGGGATAAGCC
CACTTCTTGAGTTTTGAATCAGGAGCAAGAGTGTACCAATTCTAGAGATCAATGGAACCT
ACTGATATATCCCACCCAGTGGTGTAGGCCTAAAATCAAGGTTGCAGCAAATTAAGCCAA
TCTCCCTTCCTCATGGGGCCAGTGTGCAATGGCTACAAGTAGCAGCCTCCTTGATAATGC
CTGTGTGAGAGCTACCCTAAGAAACTGGAATCAGTCCTTACCAGAAGATACTCATTTCAT
GTCTGACTACCTGCTGTCCCCCACCTTAGGTTCCATGAGGTGTATGAGATGATTTTAGAA
AGCCCCAGGGCATGATGCCCATTGCACACATTGGCCAGATCATCATGTCTATTCTCACCA
AGCTGCAGAATAAGAAGCATGTTACATATGACCAAGTTCAATTTCCTTGGCTGCCAGAAG
ACACATCTCCAAGACATAAGCTATCACCAAGTTTAATGCTAATGAATCTACAGACATCAT
GGCTAAAAGCACCTTATCACAGATTACTATGAAGTCAAATACAGTTCCAATTATGGTTCC
ATGACAAATGGTGACCCTTGTACTCCTAAGAGCCTCGGAGATGCCCCTTAAACACATTCA
ATAAATCCCACTTTCTAGCCAAAAGTCAAGTTATCAGATTAAGTTCTAATTATATGCAGC
CCTGACATTTGGTACACTCAGGAGGACCTAGAATAGTGTAATCATAACTTCTGCTTCCCA
ACTATTCCCAAGGTAAAGGCTGTCCCAGCCAATCAAGCCTTTCTTATCCAAAAGGCCAGA
TGCAGGTTCAGTTTATTCTTTGGTATTGAGTTTAAGCTCCCACATGGTCTGTGAAACTAT
TCAAAATAGCTAATCATACCCTACAGGAGGGCTATGGAAGTACTTCACCCTCTCTTGTTT
AAATGTCCACTGGAATTATTGTTGTGGCTCCACACCTGCATGATATCTCTGCTCCCGGTG
GACTCCACCCACCTTTATTTTAAGATGGAGGGAAGAGAGAAGAGATACAGCACCACTCCA
CCACTCAGGAAGCTTCCCCATGCAGTGGCTAGGGACTCAGATCCAAGATCTTGTTCATGG
TAAAGTTTGCATTCCACCAGCTGAGCTTCCCCCTCCCCCCACACACACACACACTCAATG
CTACAAAGCAAGTTTTCCTCCCATTGCCTTTGGTAGTTCGCTCTGCTTCCTAATACAACC
CTCATATGGCACCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved