Erinaceus_europaeus Locus Mono:194:SNORA5
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:194:SNORA5
Erinaceus_europaeus
Mono:194:SNORA5
scaffold_242674
SNORA5
1001..1127
2127
GAAGCTCAGAGACACCTCACAGCATATGTGTGGGAAGTGGTCCCAGGGACTCACAAGTG
CTCAGTGTCACTGCTGAGTAGCCTCCCTGGGCTAGTTGTTTCATTCAAATCTTCAGCAGA
GAGAGGACACAAAGTTCCCCCTCCACCGAGTGTCCCTGGTGCTCCCATGTGGTGCTGGAA
CTCACACTCAGAGCCATGTGCGTGGTTAGGTGTGTGCTTTACTGGGTGGGCAAATTCCCA
GCCATGAAGTGGCATACTCAGTGCCCTCATATCCTGCCCTCCCCTCCAAAAAAAAAAAGA
AAGATAAAATACTTAGGCAGAAAACCAAAGTTAGAGAAAAAAGTTCTGAAAGTACCAAAG
GACATTTTTAATTTGTAGAGTAGCAGAGGTGAGAATTGAGTTGTATTATAAGATACAGAG
TTAATATACAGAAGGCAGTTACTTTCCTAAAAACAGTAACTTGAACATGGAGAATTTGAA
ACAAGAAACAGCACAGTGCAAGATAACTAGCACCTCTCCAAAATCATGTGATACTATGTA
CAAAACTGGATAAGGCAACTGACAAGACTCTGATGAAAGATGTCAAAGAATAAAAAAATA
AAAATTCCATGGACAGGAAGTCATGTTATCAAAATGTCAGTGCCCCCCCACCCTTAACAT
ATTCAATACAATCTCGAGAAAACTCCCAGTGAGTTATTTTATGGATATTAACAGACTAGT
TTCAGAGCTTTATGGAGAGGCAGAAAGACTCAGATTAGCCAGCTCAGTACTGAGGAAGAA
CAAAGCTGGGGGAGTCACTCTGCCCAAATTAAAGACTTATGTACAACTACAGGAATCAAG
AAAATGATAGTGGTTTTAAAAAGAGAGGGAATGAAAGAAAAGACAAAGAAATGAATGGAA
TAGAACAGAAAGTCCAGAGATAGATCCTCATAGACCCAGTCAGCTGATCTTTGACAAAGG
AGCAAAGGCAACAATGAGCTGGAACAGAAATCATCTTTTCACACAGCTGTGCCACCTCAG
TGCTACCCAATCTATGGTTGGCACTGGCCCACAAAGCTGCCACTCCGACACCCTGCCTCA
TGGGCCCTGACGCCCAGGTCTCAGGGATAAATTCGGCTACAGGTACTAAGCACACACGTA
CCACCGCCACCCAGATACCAAAAGCTAATAACCTAGACTTTGGTAAGTGGTGATGGAACA
ACTAGGCATCTACCTATGCGCAAAGCAGAATCCTTAGAGCCTTTCACAAATATGAGCCCA
GAATGGATCAGGGACTCAAATGTTAGACACAAGATGACTTGGGACATCAAAGAAAACACA
GGAGGAACTTTAGATGAGCTGGCGCATGGAGATGACGGGCTCCATCCAACCCCACGCATG
CTCTGTGAGAGGAGTAATGGACAGTGTGGGCCTTGTTAAAGTCGCACGTTTCTGGTGGCT
GGGTGAGTAGCTAGCTCATGTGTAGGGCTTGGGTTCAAGTCCCTGGTCCCCAGCTGCAGC
GGGGAAGCGCACAAGTGCTACAATGTCTGTCGCCTCTGCTCTCACCCTCTACCAAAGATG
CGGCCACGGGGAATGGTGGTTTTACATCGGCGCCAACCTCAGAGATAAAGCTCCTGGGGC
AAAAATTTAAAAAGAAGAAGAAGGAGAAGGAGAAGAAGAAGAAGAAATTTCTGTTGTGTG
AAAGTCATGGACAGGAGGTTGAACAGACAAACCACAGAGGAGAAAGTACTTGCAGAAGAT
ATTGCTGATAAAAGCTATTACCCACGATATACAAATAAGTTTTTTTTTTTAATCTGTTGA
TTCACTAACACAAGAGAATGAAAACCACCAGAACATCACTCTGGCACATACCATGCTGGC
GATTGAACTCAGGGCCTCATGCTTGAGGGGCCAACATTTTTTTTTTAAGCTCTCTACTGG
ATAGAGACAGAGATCAAGAAGGAAGGGGGAGATAGATAGAAAGGGAGAGAGAGACACCTG
CAGCACTGCTTCACCACTTGCAAAGCTTTCCCCCTGCAGGTGGGGACCAGGGGCTCGAAC
CTGAGTCTTTGCGCTGTACTGTGCACTCAACCAGGTGTCTGCCACTCAGCCCGAGGGCCC
AACATTTTATCTGTTGTGCCACCTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved