Erinaceus_europaeus Locus Mono:420:SNORA38
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:420:SNORA38
Erinaceus_europaeus
Mono:420:SNORA38
GeneScaffold_4
SNORA38
1001..1140
2140
TTAAAAAGTCATAGCATATTTCACGACCACACATTACATCACATTAAAAAAAAAACTTA
CCTTAGTATAATGCAAAAGGGAATTGGCAAAGAAACGACACAATTTGAGTGTTTTCTGAA
ATAATCTGTAGTCAGCACTATCCTATTCCCAGAAAAAAAAAAAAAGAGTAAGAACATGAA
TAGGAAACAAAAAAGCATAAGAACAAAAATGGGACAGTATTATCTAAAAATGCAATGTAG
ACATTTTCTTTCTCTCTCCCTTTCTTCCTTCCCTCCCCCCTCCCTTCTTTCTTTCACCAT
AGTACTGCTCAGCTCTTGGTTTATGGTGGTTCGGGGGATTGAACCTGGGGCTTTGGAGCC
TCAAGATAAGTCTCTGCATAACCATTATGATATCTATCCCTGCCCCAGTGTAGACATTTT
CCAAAAAAACCAATTCTGAATTGTGATTAGAATTTTAAAAAAAGGCCAAAATGACAAAAA
TGATAAAGAAAAATTAAACTCTGAGAAGTTTCTGAGAAGAAATCTTACTGCACAACAGTA
AAAAAAATAAAGTGATTACTTTTTCTTTTTTAAAAAAATATTTATTTATTTATTCCCTTT
TGTTGCCCTTGTTTTGTGTTGTAGTTATTATTGTTGTCGTTGTTGGACAGGACAGAGAGA
AATGGAGAGGGGGGGACGACAGAGAGGGGGAGAGAAAGATAAGATACCTGCAGACCTGCT
GCACCACTTGTGAAGCGACTCCCCTACAGGTGGGGAGCCGGGGGCTCAAACTGGGATCCT
TCTGCCAGTCCTTGAGCTTTGCACCACCTGCACTTAACCCGCTGCGCTACCGCCTGACTC
CCTAGGTGATTACTTTTTCAAAGAGAAAGACATTTAAAGAAGCTTTAACCACATGAGGAT
TAAGTTAACAAATGGTCAACAGTAAAGACTATAAAACTAATACAGAATAGACAAAAGGTC
AAAGACCTGAGAAGCAGATCACAGGAAATACAAATTGCCAACTCTCCTACAAAGGTATGT
CTGTGGTTCCTATCTTTGGACATGGAAGAACTGGAGGTAAAAAAAAAAAAAAAAATAGAC
TTAGAGAAGTCTTGGGCCAACTCGCTCTCTGCAGGGCTAACAATCAACCCTTCTCACAAA
AGAGAAAAACAAACAAAAAAAGCGCACAAACCCACATTACTAATATTGAGAAAGTGCAAA
ATGAGAACTTAAGTACATATATTCTGAGGGAAGAAAAGAGAGAGTGAGCGAGAGAGAGTG
CGGCGCAAGCTATCTGATTAGTAAAGATTCAAAAAGATGACAGTCAGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCAGTAGCGCAGTGGGTTAAGT
GCACGTGGCACAAAGTGCAAGGACCAGCGTAAGGATCCCGTTTCAAGACCCCAGCTCCCC
ACCTGCAGGGGAGTCGCTTCACAGGTGGTGAAGCAGGTCTGCAGGTGTCTATCTTTTTCT
CCCCCTCTGCCTTCCCCTCCCTCTCTCCATTTCTCTCTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved