Erinaceus_europaeus Locus Mono:363:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:363:SNORA70
Erinaceus_europaeus
Mono:363:SNORA70
scaffold_309139
SNORA70
1001..1136
1632
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCTGCCCTATCCAACAACGACAACAACAATAAAACAACAAAGGGCA
ACAAAAGGGAATACATAAATTAAAAAAAAAAAAAAAAATTAAAAAAAAAAAAAAAAGAAA
GTGTTCCCAGGGGCCGGGTGGTGGCGCACCTGGGTGAGCACATGTATTACAATGCGCAAG
GACGCAGATTCGAGACCCCGGTCCCCACCTGCTGGGAGAAAGCTTGTGAGTGGTGAAGTA
GTGCTGCAGGTGTCTCTCTGTTTCTCTCCCTCTCTATCACCCCCTACCCTCTTGATTTCT
GGTTGTCCTTATCCAATAAATAAAAATCTAAAAAAACATTTTTTAAAGAAAGTGTTTCCT
ACTCTGAGGTCAATACTCTTATTTTATTTCTAAGTTTTGTTGTTGTTGTTATTGTCTTTA
TTTTATTTTATTTTATTCTTCCCTCCAGGGTTATCACTGAGGCTCGGTGCCTGCACTACG
AATCCACTGTTCCTCAGGGCCATTTTTTTTTTCCACTGCTATTTTGTTTTTGAAGTTTAT
TTGTCACTTTCCTTAACTTTGTTGAGATGATAATTGTCTTTAGACATCATCAGAAGTAAC
ATATCTACAGAATTATTTTTTCAAAAAAAGTCAAATCAGTAATGAAAAGAAACTATCCAG
CCCATTCTCCTTTTAGCCATAAGGCCCAGTATTCAGTGACTACAAACAAGCAGCTTCCTA
TTAGTGTACACAGTACCTTGTTTGTATGAGTTGCACCAAAAGACCTTGGAAACAGACCTT
TGGGATTAAAATTCATACTTGACCCTGCTATTTTTTGGGCTCCCAGACAGGTATGCTGGG
TGCCACCCTGAAAGCCCCCAGAGTACAGTAACTAGGATCTCCATTGGTTAAGTCATCATG
CTCATGAGGAGCAAAACAAAGACCTCAAAGCATGTGAATTGAAGTCCTTCACAGGGAAAC
CAAGGTAAAGTTCACCAGCTGGCAGCAGATCCACAACTCCAAGTGGGACTTTAACAAGTT
TAATGAGAATCAATCTGAAGACATGATAGCTGCAAAAGAGTTCATCCCAGATAGCTGTAG
AGTCAAATACATCCCTACAGGTAGCCTCCTAGAGAATGACTGAACAACATTCAAGAGCCT
CAGAGCTACCCCCTATACAGTAATGTCCACTAACAAATACTAATTCCTATACAAAAAGAG
AGCAACATAGAGAGAAATCAAATGATGAACTATGTCCCATCGAAGAATATCAAATTTAAT
TTAAAAAAATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved