Erinaceus_europaeus Locus Mono:254:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:254:SNORA73
Erinaceus_europaeus
Mono:254:SNORA73
scaffold_295635
SNORA73
1001..1201
2201
GCACAGATATTGAAACCAGAAGCCTAGTATTAATATAATTGAATGTTAGATATTATTGG
AATTTCACTAAGAATGTCCTTTAAAAATAACTTGTTGGGAGTCAGGCGGTAGCGCAGTGG
GTTAAGCGCAGGTGGCGCAAAGCGCAAGGACCCGCGTAAGGATCCCGGTTCGAGTCCCCC
AGCTCCCCACCTGCAGGGGAGTCACTTCACAGGTGGTGAAGCAGGTCTGCAGGTATCTAC
CTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACA
ATGATGACATCAAGAACAACAGTAATAACTACAACAATAAAGCAACCAGGGCAACAAAAG
GGAATAAATAAACAAATATTTTAAAAATAACTTGTTAAAATTCAGAAGTTTTAGATTTAA
GAAAACTGAAAAGAAAAACTGAGAAGATAGTGCAGAAACTTTATGTGTCTTATAGTTTCT
CAACTTTTATTAACATCTTGCTGGGAAATACTATAATTGTTATGCAAAAGACTTTTATGC
TCAAGGCTCCAGAGTTCCCAGATGTCCCAGATTCAATCACTGGCACCACCATAAGCCAGA
GCTGAGCAGTTTTCTAGTAGAAACAAAACAAAACAAACAAGAATCTATTTCTTAGAGCTA
TCTTTTAAATCTCTTTACACTTTACTAGTGAATCGCTCTGCCATTTGTGTGACTCAGGCT
CAAGGCCAAACCCCCCACCCCCCACTCACTGAAAAAAGATTTGGTACCATGGTATCTTTC
AGTCTATTTATCTTTACCCTTCTGTCTCTCTATTAAAAATATTAATCAGAAAAAAGTGGT
TTAAGGAGATAGCACAATAATTCTGGAAAAATACTCTCATGCGTGAGACACTGAGGTCTC
AATATGCAGCACCTCCATTAGCCAGAATTGAGTAATGCTCTGGTCTCTCTTGCTCCCTGT
ATCTTTCTCACTAAAATGAATACAATCTTTAAAAAGAAAAATTGACATGGATACTCTGGG
AGATCACTTTTTCAGGCTCTGTCCAGGTGGTGGGTGGGAGTGCAGGGCTCTGCTCAGTGA
CATACAGTCCCTTTCCAAGGTGTCGGAGATGAAGCCGGGCCCTGAGTCTGCGCATGCATA
TTCTTACAGCTTCACAGAGTCCCATGGACCGTGACTGAGGACACAAACCATGCAGAAAAC
ATGCTTTGCTTGTGTTGATTTACAGTAAAATAGATAAGAATGTGTCTTACACACTTGTTT
TTGCTCTTTCAGGGGAGATGTCTTCACTTGGCTTTAGTTAACTTGACTATATTGGGATCC
TTTGTCTGGCAGGTTGTACAGTGAATCATGAGTTGAAGGTCTATCAAGATAAGAGCTCAC
TGGTACAGTCCAAGCCTGGCTATAATAGTGCTATTACATGGAGGGCAGAACTTTAACTGG
GATACGAAATAGTAGGTACCAACTAAGGAAAAGGGTAACCCTGAGAATTTAGGTGTCTTT
CAGGGGTCTGGGAGGTGCACCACCCAACTTAGTGCACAGGGTCCTGTTCCCACCTGCAGA
AAGGGAACTGAATGTCTTTTCATTTCAATCAAATTCTGACTGTATATATTATAAAAATGA
ACAGATCTGTGTTTCTGATTTCCAAAACCAAATAGAAATTAATTTTTTGTAGATAAAAAA
AGCAGGCAAAAGAGTAGACACAGCCAATTATCAGTATCTTGCCTCTCAAATCTAAATTTA
TTCTTCATTTCCTGATATGCAGAAATGGAGTTGGGGTCTATTCTTTTTCAAATGACAGCA
TGTCAAGCTTGGTCAGTAGAGGGCGATGGAAAGACATTGCAGGAGGAGCATGCACTCACC
TGATCTGTGGGTTCCTTCTGTCAAGCTCTGTCCATGACAGCAGCATCCTGCTCTAGCCTC
CTGTACTACTTGCAGTTTGCTCAATGTCCAGCACCTGCTGTATAGACAGCTTCCTTAATA
TCAGATGCTAGCAGCCGCCTCCTCAATGCACAGCAAGCAAATAATACACCAGCCAGCAGC
CTCCCAGGCACTTTTCTGGAACAACCTCAGCAAAATGCCCCTGTGAGACCTCTCCCCATG
AGCAGTCTTACTGCACCATAGTGAGTGGGTTTCTGGAAAATTCTGACACTATGGCTCCAA
CATGGATTTTCTGACATTCAGTGAGCTCTTGCTATGCCCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved