Erinaceus_europaeus Locus Mono:331:SNORD62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:331:SNORD62
Erinaceus_europaeus
Mono:331:SNORD62
scaffold_342523
SNORD62
1001..1086
2086
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCACAATGC
ATACATATATAAGTTTTGGACATTGAAATTTAAAGGGATGAAGAAAGAGCTGATAAAGTA
GACCTTTTCTGTGTTCTTAAAATGAAAAAAGTATAACTCAAAATTAGAAGGCTGTAACTA
TAAGAAATTATACATTATCCCTATGGTAAGCATAAAATTTTGCTGAACGATATATGGTAA
ATAAATGACAGTGGAAATTAAAATTTTCAACAGAAAACAACTAAGTATGGAAAAAAACAG
TGATGAAGGTATGGAAGAACAGTAACAATATCGTACGAGTGTCTCAATGATCCAATTTCG
ATAGATTCTTCTGATCCTCCACTGTGGACTCAATAGCAGAGAGATGAAGAGGAAAGAAAA
GAAAAGAGAAAGAAAAAGCATATTGTATGAGTGTAGAAAATAAATTATAAAATATCAAAA
GTAAGCTATATTTTTTAACCAGTAATTATTTAAAATGTAAACAAATTAAACTCTCCAGTC
CAATGCTAGATATTTGAAAAAGAAAAATAATTTAAACAGAAAATATTATTTAACTTCATG
ACATCAACAAATGACTTGGTTTATTATCATATATAGTATGAAATGAAAATGAAATAACAA
ACATCCCTTCTGAATAGCAACCCAAAGAAAGTAAAAGCACCTATACCCATATCAGATTAA
ATATAATTTGAATGAAGCAAGCTTGCAAGAAGCACGTAAGATATTGTGTAGCTATAAATT
GTTCACTTTAGTAAGAATATATAATAATTTCAATTTAGGAACAGTAAATATAGTTTACCT
GGTTGGATATCTGACTTACCATGCATTCAGCTTAAGTTCAAGTCCCAGTACTACACAGAA
GTGCCATGATCCTGGGAGACACTGTAGTGCTATAGTGTCTCTTATTCCTATCTCTATCTA
CCTATCTATTTATCTATCTATCCATCCATCTATCATCTCTCATCATTATTATATATCTAT
CTTTTATCTGAAACAGTTGGCTGAGATTAGTAAACATTATACTTGCATGAGTTTCCTGAA
ACAAATTATAAATATATATGTACCTAAAACAAATCAATGAGATATATGAAGTAAAGTAAA
CAGAATAAAAGGGAAAAATGGATAACTCTATAATAGTAGTTGAAGACTTTAATAAAAGAC
TCAATAAAGTATAAAATAGGTAGGTAGAACAAGGCACATAAGGATATCAAATACCATTAT
AATCCAGAAACATTTCTACAGGAAAGTCCTGTCCAATAATATCAGGTGCACTTGGGAGAA
TTTCCAGGATAGACCATATTTTAGGCCCCAAATTATGTCTTACTCCACTTAGTAACTTTA
TATGCCATAAAACAAATCTGAAAATTTCACTATATTGTAAAAAGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved