Erinaceus_europaeus Locus Mono:238:SNORA21
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:238:SNORA21
Erinaceus_europaeus
Mono:238:SNORA21
scaffold_305670
SNORA21
1001..1135
2135
TGTGTCTGTCTGTGAGTTCATTTAGTTTTTATTTTGGATTAATTATAGAGAACTCCCAT
GTAGTTTACACTTACTTTCCCCCAGGTGTTGTTTCTTTTTTTCTTTTTTTTTTTTAATTT
AGCTAGAGCACTTATCAGCTCTGGCTTCTGGTAGTGTGAGGGATTAAACCTGAGACTTCA
GAGCCTCAGGCATGATACATCACCATTATGCTATCTATGCTCCCTACCCCAGCCCTGCCC
CCATTTTCTTTTCTTTGCCTCCAGGATCATCACTGGGGCTCACTGCAGGCACTGTGAATC
CACTACTCCTTGTGGTATTTGGTTGGGTTTTTTTGTTTGTTTGTTTGTTTGTTTTTAGGA
CAGAATGGAGAGAAGAGAGAAAGATGAACATCTGCAGACGTGCTTCACTACTCCTGAAAC
TTCTCTGCTAAAAGTGGAGAGCAAGGGCTCAAATCTCTTGGTCCTTGAGCCAGTCCTTGT
GTATAGTACTGTGTGCATTCAACCAGGAATGCCATCCCCTCTCCCCCCGCCACCCCCTAC
CTAGTTTTCTTAGCTCATGTTACTGTAGCACATTTTCAAAACCAGAATATTGACATTGAT
AACAGTGGGTAGTTCTGTCCCATTTTATCACATATAAATGCTACCATCAAGAAAAAGAAC
TATCATCAGAGAAAGATCTCCCTCATACTGTCCTTTTGTATTTCTACATATTCTGCCTCC
AGCTTTTTTTTTTAATGTGTAGGAGCTAATTTCATAAATCAAATATACAGCGCTTTAACA
AATGCCTCTTATGTGAGTGGTTGGAGGTATGATACTCTTTACAACTGAGATCTGATTTAT
TCACATTGTATTCAGTTCTTTTATACTACTTTGTAGTGGTCCTATCATCTAAATAAACCA
AAATTAACACTTCCAAGTACACGTGAAGCTCAAGTATCTTCAGCTTCCTGTTTTTTTGGG
TACTACCCTGGTAATTATGTTAGTTAAATACATTTACTTGAACCCCTTTAAAAGCACTCG
CTGGGCCTCTTACTAGTGACCCATTGAGCCGTCCAGAAAGGGAAGAGTAAAGACACCACT
TTTGGGTGAAGCGACAGCATGTTGTGTTGTTTGCTTCAATCGGTGGTGTGACAAGTTACA
CCACATTTGGCAACTGTTTGGGCGTGTGAATGGGTGGGGAGACATGGATATCAAGGGACA
ACTGAACAGGCTTCCTGCTGCTGGTGTGGGTGACATGGTGATGGCCACAGTCAAAAAAGG
CAAACCAGAGCTCAGAAAGAGGTACATCCAGTGGTGGTAATTCGACACAAAGTCATACCA
GAGAACAGATGGTTTATTTCTATATTTTGAAGACAATGCAGGGGTCATAGTAAATAATAA
AGGGGAAACGAAAACTTCTACCCTCACAGGACCAGTTGCAAAGGAGTGTGCAGACTTATG
GCCCAGGATTGCATGGCAGTGTTGCATGATTCTTCAGTGTATTTGTAAAAAATAAAAACT
TATTTGTTCCCATGAAAAATACATTTACTTGAATATGAATATATATGAATATACATACAT
ATTCCTATTTATTATACTTCAGCTCTTTTTTAGGTTGTTAGTGATTTAATAATGATGTAC
AAGATTGTGAGATAAGAAGGGTACAATTCCCACCACCAGACTTCTGTATCCCGTACCCTC
CATTGGAGGTTTCCCTATTCTTTTACCCTCTGGGAGCATAGACCAATGATCTTTATGAGG
TGCAGAAGGTGGGAGGTAATAGGCTTTGGCAGGTGGATCCATAACCCTAGTGGGGCAGCG
GTCTGGAGAGGTGGGGTTCCAGGACTCATTGGTGAGGTCAGGTTGGCATCCTGGTAGCAC
CTGCAACTTGGTAGCTGAAAAGCATTAAGATATAAAGCAGAACAAATTGTTTAGTAATCA
GGAACGTAAAGGTAAAAAAATAGCAGATGAGATTTGAAGTCTCCATTTTGGCAAAAGCTT
ACAAGTCTGTTTTAGTTATATCCCAGTGGGTCCATGACTTTACCAATTTTTGCCTGGGCT
GGATAGCTAATGTGCAGATAGGCTAAACGTATTGTCTGAGAGGATTGTGTCAGTTGGAAA
TAGGATCCTAATCCAGCTCTCAACTCTTTATTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved