Erinaceus_europaeus Locus Mono:232:SNORA17
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:232:SNORA17
Erinaceus_europaeus
Mono:232:SNORA17
scaffold_236510
SNORA17
1001..1131
2131
GTGGATAAAGCATCAGACTCTCAAGTATGAGGTCCTGAGTTCAATCCACGGCAGCACAT
GTACCAGTGATGTCTGGTTCTTTCTCTCTCTCTCTCCTCCTATCTTTCTCAAGCACATGT
ACCAGAGTAATGTCTGGCTCTTTTTCTCTCTCTCCTATCTTTCTCATGAGTAAATAAATA
AAAGATTAAAAAAAAAAAAGAAATAAACCTGGGCGGAGGGTAGATAGCATAATGGTTATG
CAAACAGACTCATGCCTGAGGCTCCAAAGTCCCAGATTCAATTTACCACCACCACCACCA
CCACCACCACCACCACCACCACCACCACCACCACCACCACCATAAACCAGAGCTGAGCAG
TTCTCTGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCACTGCATGTGCCAGAGTGACGCTCTGATGCTCTGTAT
AAACAAATCACTAATAGAAACGGTCTCCCAGAGTCGGGCGGTAGCGCAGTGGGTTAAACA
CAGGTGGCGCAAAGCACAAGGACCGGCTTAAGGATCCCGGTTGGAGCCCCCGGCTCCCCA
CCTGCAGTCAGGGCTTGGGGAGTTGCACATAATCACAAGCAAACCTGGGTTACACAGCAG
TCCCTGAAGTGCTTAATGACTCTTTGAAAGGACAGGTTAGGTAAAGCGTTCTGTCATGGA
AGAGAGGGGCCAGACAAAATCCACATCAAAACAGCTCACCCCCTGCCCCTAGAGGCGTTA
CAGATGTGACTGCTGTGTCACATGTGTGTCATTAGGTGGCAGAGAGAAGAGAGGCTTGTC
TACGTCCAGTGCTCTGACCTGTGAGCCACTGGGTGATCGACAGTCTGACACTCAGCACGG
CGCCCCCACCTGTTACTGCGTGTTTATTGGCGACCCGAATCCTGTCGTGTAAGAAAACTC
TTATTCTTCCTTAGTTCCTGCCTGCCCTCAAGTCTCGAGGCGACCCTGTGACCTGAAGAC
TGGTGTTCATCCCTGTTGGATGAAGAGTGATGGCTCACATTCAAGGGGAAGGTAGATGGC
CGTTAGCCTGTGACAATGACCTTATGGAATGTCTGACCTCTGTCCAAGCCCAGGTTACCA
ACCAGCCCAGCATCCAGAGGTGGCGTTAGATCATCTGAGAGATCTGATCACCAAATGGTA
CAGTGACCTTACCAGACAGACCAGTACCCCATCCTCAACCTTGTAGCAGATGCCAAGAGA
TTAGAAAAATGCTGGAATGGAAGGCTACTCTGCATTCTCCAGAGGCATTCACACAATCAT
GGAGATCCACAGCTGATCAAGCTCAGGGCCTCACAGCACTGAGTACTCCCCCACTGCTAT
CCTAGTTCATGAATTTGGGAGGGAGGGGGGTGTGTTTGGTTCCCTAAAGTAAAATTAAAG
GGACTTTGAGGAATTTGAAAATAAACTCTTGACTTGTAAAAAAAAAAAAAAAAAAAAAAA
GGTTCACCCTCAGTTGGCACATTCTGGAATTCTTCTGCTATAAAAAGTCAGCAATGGTAG
AGACTTACTGTTAGGGCTTGCCACCTGCCAAATAACGTACGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTTAGGTATGTGTAGGTGTGTGTGTGTGTGTGTATGTGTTAA
GTCTAAGAATTGGGCATGGAGCTCTGTGGTAGAACATGCTTGTCATATGTTCTTTTTTTT
TAAATTTATGACTTTATTTATTGAGAGAGAGAAAGAGAGAAAAGAGGAAAGGAGCAGATG
GAGGGGAGGGAAGGGGATGGGAGGCTGGAGTCCTGATACCTGAGAGCTGTTTTATCCACT
GTGATACCTGTCAGGCTGTGCCACTGGTTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved