Erinaceus_europaeus Locus Mono:249:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:249:SNORD116
Erinaceus_europaeus
Mono:249:SNORD116
scaffold_68929
SNORD116
1001..1098
1477
CTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGCCTCTCTTGTTGGGGACTGG
CACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGCTGATGCTGTTGTAGCGC
TGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCTCCCACGGGGACCCACTC
TCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGTGGGTGCTGCAGGGAGGGGC
TGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGGATCTGGAGCCGAAGGCGAAGGTGAAG
CCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCCGCCTTCTGCCCTTTGG
CAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCCACTCACACCAGCATTCCTTGG
AAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGTCCAT
GCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGGACACATGCCTTGCCGGGTCTT
GCCTGCCTGGTTGGCCTGGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC
CTTGCCTTGCCTCGCAGCGCCTAGCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACC
TAACCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCACTCCCACTCCCACTCGCACTC
ACAGTCCGTCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAG
CTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGT
CAGGGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGCCGCCTTGTGGTGGCCTGCATGGC
CTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGGCATGGTTCT
CAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCATTGTCCTGT
ATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAGTCTCCAGGGGTCAGAACCAT
GGCCCTGAGTCTCAGGCCTTTAGCGTACCTTCATGAGGCAGAGGGAGTCCAGCGGTGTGG
GGTGTTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAGTTAGAAAGCTGGACTGGGTCCT
GGGATCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCAGGCAGCCGATGGGAGAGGGAGG
CTGGGCCTGGGCATGGGCATGGTCCTGGGCCAGGGCCTGTGCCAGGGCCCAGGTCGCGCT
TGGTCCCCAGATTTGGGGGCAGCCTGAGTTGCAGGCCCCATTTGTGCCTGCCGTGCCCAA
GCAGGAAGGCTGGTCTGGTGTGGAGGTCGCACAGTGGTGATGGGGAGGCCCTTGCATGTG
GTATTTGGGCCCCTGGAGGGCCAGGCGGTCACCTGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved