Erinaceus_europaeus Locus Mono:1:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:1:SNORA73
Erinaceus_europaeus
Mono:1:SNORA73
scaffold_352085
SNORA73
1001..1208
2208
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNATGGTAGCATGGGCACTTTAATGAGTATGCCACCACTTGGCT
CTTAATCTATTTTTATTCTATATACGTTCCCCTCTTTGCTATAACCTGATCTTCACAGTA
CAGTTACTGAGTGGCCAACTGCCTTGTTGAAGCTGACATTGTGTGCTTCTGAGAGTCAAA
ACCATCTTGCAAAGGAAGCAATAGGCAGTTTCTTCAATGGAAGGATCCTGAAAGAGAGAG
GATAGAAAACAGCACACCTGAGAGAATGCATGCACTACCACTCAAGTCCCTGGTCCCCCC
CACCTACTGCAGAGGGTTAAACTTTGCAAGGAGAACACTTCACAGTGTCTCTCTTTTTTC
CTCTCTCTCTCCTACCCCCTCCTTCTCAACTTTTCTTTGTCCTACCAAGGAAAGAAAAAA
GGAGAAAAAGAGAGAGAAGAGGGCTATTGGGAGTGATGGATTTGTCATACAAGCATCAAG
TCCCAGCGATAATCCTGATGGCAGTAAAGAAAGAAAAAGATAAACAGCCACCAGGAATGG
TGGAGATGTAGACACCGAGCACCACAATGCCCATAATTGCAGCAGTGTGGGTATCCTGGG
AGGTCCCAGCCCCCAGGCTCTGTCCACGTGGCGCACGGGAGGGAGCTCAGGGCTCTGCCT
CACTATGTGCAGTCCTTTTCCAGAATTTTGGAGATGAAGCTGGGTCTTGAGTCTGCACCT
GCATAGTCCTAAAGCATCTTAGAGTCGCACAGACAGTAGCTGAGAAGACAGTGCATGCAG
GAAACAACCTACCAGAGAATTTTACCTGGGTACAGATTAATTTCTCCTCTCACAATATAC
TACTAGATAACCATAACTGCAAAGTAGAAAATGAAAGGCAAAGGAAAAAAGCAAGTTTCT
GTCCTGTATTCAGTGGTGATTCTGATTCTGAGGGATGTTCTCTTGAACCCAGAAATTGTC
ATGAATTTTGTTTTTGTGAACAAATACAAAACTATACATGTGGTGGGAAGTCCTTCCAGT
GTGAAGTCTGTGAACTTCTCTGTAAGTGAGAGGAGTTGGGCCTATGCTCAGAAGTACTTG
GCTTCTATTCTGAGAGGCACTAGATCTGAATGCCTCTGTTTGGCACCTGTGATCCTGGAT
AATTCCTTCTGAAACTAGGGAGGCAGGGCTCATGATGGTGTCACAGACATTTGAAAAGCT
TGAGTACTATCATAAACTTTGGTTTGCAGAGTGGTTTATTCCTTGAGCAAACGCTGATTG
ATTATCCTACTGTGTGGGAAGCACTATCCTAGAAATGGGGATTATTGTTTTTACATTCCC
AGAGTGGGAAGAAAAAAATTCACACTATATATAGTAGTTCAGTGGGAATATTGGGGTGGG
GAGAGGAGGAGTAAAGGCAGGTGGGGAGGTGACTCGGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved