Erinaceus_europaeus Locus Mono:372:SNORA36
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:372:SNORA36
Erinaceus_europaeus
Mono:372:SNORA36
scaffold_207283
SNORA36
1001..1132
1559
GACCTCATGTCTTGTTTTTGGCCTATAGAACACAGCAGCAAATGCCTGGACCAATTGTG
ATGCTATGTATTAAAAAATTTTTATGGGGCTGGGCAGTAGCACAACAGGTTAAGTGCACA
AGGCAAGAAATGCAAGAACCAGAATAAGGATCCCAGTTTGAGCCTTGGGCTCCCCACCTG
CATGGGGGATTGGGGGGGTCTCTTCACAAGCGGTGAAGCAGGTCTGCAGGCATCTCTCCC
ACTCTGTCTTCCCCTTCTCTCTCTCGATTTCTCTCTGTCCTATCCAACAAGAACAGCCAT
AATAACAACATAACAATAACAAAAACAATAACAACGACAACAAAGTAGGGGAAATGGCCT
CCAGGAGTGGATTTGTAGTGCTATCATCAAACCCTAGCAATAACCCTGGAAGCAAAGAAA
ATAAAAACTTTATAATCCAGTGTTCAATTCAGGACAGTTTTCCTGTTCTGTTAATTTAAA
TTTTGGATATTGAAACTTAGACTAAGGGGGGTGATTGGGTAGAAGTACTACTCTATTAAA
TTACTTCCCAAGCTACAAAAAGTGGAACATAAGGAACCAGCCTAGACATCCATCAATAGA
GTGGATAAAGAAGTTCCATATATATATAGTATCAGTCAAAAATATGACAGTGTATGGTTT
GGGATAAAATGGATGGAACTAGAGGTTGTTATGCTAAATGAAATAATAAGTGAAAGACAA
CTAACTACATTTTTTTTTCTTGTTGTCACTGGTTTCCTTGGAAATATGTCCTCACTCTTT
GAATGATTTTGGTTTTGTTTTTTGGCTGAGGAAGGACAATGAGGTTCTGTCACTCTACAA
GCCCAACCAATAGTCAGTCAGGCACTGGACATAAGCCAGTCTCTATGAGTGATGACTGTG
TAGCGCCTGTCATAATTACCTGAGCTGGATCAGATCTACAGAACCACGAAACTGTGAGAA
CTAACAAGTGGTGGTTGTTATATAGAAATCCAGTTATTGATACATAAAGTAAGACTACTG
CTTTCCCCACAAAAAAGACCCCCCCCCAATACAGGATGATGGGAAAGAGAAAAGGAAAAA
TAGCAACAAAGATTAAGTATTTCCAAGGCAAGAATTAGGTCTTATCAAAATTTATTGTCC
TTAAAAACAAGCACAATACTGTGCACAGAGACATTCAATAAATTGTTTTTAAGGATGAAT
GATATTCAGAATTTTCAGTATGCCTGAGAGCCAACTGTATACAAGGACAAGCAAAAATGT
GTATCACATTTTATGGCAGAAGATTAGAAAGAAGCAGCTTTAAAAGTAAGGAGAAATGAT
CTTGATTGCAAACAGTTGGAAATTAATAGTTTTCTTTATCTGAAATGATGTTTCTCATGC
TCCTGGGATCATAGGCAGGCAGCCCTTTCAGCATTGCACCCCAGGATTAACATCTGTGTG
AATGTGGCAAGAGACAAAGGCAGGGTGAATGAATTCCTGTATTGTTCTCATTGACATTAA
CAAATATATTTCTTTGGATGATTCCAGTTCACAGGTGCACTGGCCACACACTAATTGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved