Erinaceus_europaeus Locus Mono:296:SNORD113
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:296:SNORD113
Erinaceus_europaeus
Mono:296:SNORD113
scaffold_121069
SNORD113
1001..1073
1579
CCCTTCTCTGTATATTTTGTTTTTTTTATGATATGTATTTTATTATTTACTTATTTATT
TATTTATTGGATAGAGACAGCCAGAACTTGAAAGGAAGAGGGAGATAGAGAGGAGAGAGA
CAGAAAGACACTTGTAACACTGCTTCACCACTCTCAAAGCTTATCTCCTGCAGGTGGAAA
TAGGGGGCTTGAACCAGAATCCACATGCACTCAACCAGCTGCACCATCACCCGGCCTCCA
TGATATTTATTTTAACACAAGAGAGATAGGTAGATAGAGAGAGAAAGGGAGAGAGAGAGA
GAGACCAGAGCCCTGCTTAACTTGGGTTTATGGTGGTGCTGGGGATTGAATCTGGGACCT
TGGTGCCTCAGGCATGAAAGACTTCCATATAATCTTTATTCTGTCTCCCCAGCCCTATAC
TTTATAATTAAGAATCTCTTACAGAGGGTGTCGGTCAGTAGCACAGCTGGTTAAGCGCAC
GTGCAAGGACCAGCATGAGGATCCTGGTTCGAGTCCCTGGCTCCTCAACTGCGGGGAAGT
CGCTTCACAGGTGGTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCCTCTCTGTCT
TCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAATGATGACATCAATAACAACAA
CAATAAAATAACAAGGGCACCAAAGGGAATAAATAAATATTTTTTTAAAAAAGGGAGTCG
GGCGGTAGTGCAGCGGGTTAATTGCACATGGCGCAAAGTGCAAGGACTGGCATAAAGATC
CCTGTTCGAGCCTTCGATTCCCCACCTGCAGGGGAGTCGCTTCCCAGGCGGTGAAGCAGG
TCTGCAGGTGTCTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCT
CTCTGTTATATCCAACAACAACAACCATGATAACTGGGAGTCTGATGGTAGCGCAGCGGG
TTAAGTGCACATGGAGAGTCTGAGTGGGAGGTGTCCAAGCTGGGACCAATGATGAGGACA
CTGGGGGTCTCTGAATCAACAGTCTTGATTACACCCTAAAACTCTGAGGTCAGAGCCCCC
AGTTTTGAGGACAGTGACCTTGCAATTAAAGGTAATGGCATGCAGAGTTTTCTTCTGAGG
CTGTTAGGGCTCAGAGTTCTGGAAGGCGTTAAACTTAGGAGAAGTGTGTCCCGGCGCTAG
GCTGTGGCTTTCTAAGCCTCTGTGTCCAATGGTGCTGAGGTAGTGTGAGGCCCAAGCATA
GAGACAAGACCCCCTCAGGATTTTGTTCAGGAGGTGTGACTGGCTTATTCACCACCCAAA
AAAAAAAAAAAGACAGGAGGTTCGAGCCCCCGGCTCCCCACCTGCAGGGGAGTCGCTTCA
AGGTGGTGAAGCAGGTCTGCAGGTGTCTGTCTCTCCCTATCTCTGTCTTCCCCATCTCTC
TCCATTTCTCTCTGTCCTATCCAACAACGATGACATCAGTAACAACAACAATAATAACTA
CAACAACAATGAAAAAAAACAAGGGCAACAAAAGGGAAAATAAATATTAAAAGAAGACCA
TCTGGGTGACGTCTGGGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved