Erinaceus_europaeus Locus Mono:327:SNORA53
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:327:SNORA53
Erinaceus_europaeus
Mono:327:SNORA53
scaffold_67155
SNORA53
1001..1242
1243
CGGATTCTTTCCCCATACCAGGGGTCCTTCAGATCAGGTTGAGAAGAAGGGGCTACCCC
AGAACAGTACACGGAAGGAAGCCCTTCTTTGCAGTAAGGTAGTGCCTCTCCAAACTCCGG
TGCCTTGGGGGGAACCAGGTTCTAGTGGACGTTGGTCCTTTCCTCCTTGGTGGCTGCACT
TTGTGTCTGCTTTGCTGCTTTGCAGTACTCTCCAGGCGCTTTTTCCCCAAGCAGAGAGGA
GAGCTAGTCGCCGTGGTTTTGGCTCCGTCACTCGGGAGAGTTCCCCTGCGAGGTGCGGAG
GACACACAACCTCAGGAGACGCACAGGTGGACGAATAACCTGTGACCCTCAGTTGAAATT
CCTGTGTTTTCTCATAAGACAGGAGCTAGACTGTTTGTACACCCACCAAAATGGTTTGAT
AACCTAAACACAACATAGTTTCAGAGATGACATGTGAATCCTGGTCATCTGTGCTCACAG
TTAAGAATTTGCAGCGGGGGAGTCGGGCGGTACTGCAGCAGGTTAAGCGCAGGTGGCGCA
AAGCACAAGGACCTGCTCAAGGATCCTGGTTTGAGCCCCCAGCTCCCCACCTGCAGGGGA
GTCACTTAACAGGCGGTTAAAGACAACAAGGGCAACAAAAGGAAATAAATAAACTTTAAA
AAAAAGAATTTGCAGTGGGGGGATGTGTCAGAATATAGCTCTTCATAGACAGTGAGCCAT
GTGTTATGACCCTGGGTTCAGGCATCAGGCTCCATGTGGGAGCAGCACTATGGCCGGCTG
CCTCCTTGCTCCTCCCACAGAGGCTTGTGTGTGCAGAGGTGCTAAGTCGAGCGTCCTGAG
CTAGCACCCAGGTTCGCTTCCTGACGTCACAGCCTGCACACACGTGGACCAGAGGGTGGC
TCTGCGCTCACCTTGCGGCCTGGGGGTGGGCGTGGGTGGCAGGTGCTTTGCATTCTCTGT
GCTCAGAAACGGCCGAGCCCCAGTGCACCCATTCCCAGGGCAACATGCTGCCTTAGATCC
ACCTTTGTGGATGTCAGTCTTGAACTGAGTTCTGCTCGCAAACTTCCTGTTTCTTGTAGT
TCCAGTCAGAGACATCCGGCAACTTTTTTGGTTGTACAGTCAAAGGTGCTTGAGTCATTG
GCATGTGAGAGAAATACACCTGCATGTTAGTCTCCAGTTCTGGTGGGATGGCAGCAGCCG
GCTGCCATTCGCTCCGCCAGGACTCGACTGGTGTGCGGACACGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved