Erinaceus_europaeus Locus Mono:44:SNORA35
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:44:SNORA35
Erinaceus_europaeus
Mono:44:SNORA35
scaffold_282773
SNORA35
1001..1130
1338
TAGTATTTTACATATCAAGATTTAAAATTAATCCAGTCATATGCACTTGAGATAAGATT
ACTCTTAGAATTTCAGGGTGGCATCATAAAGTAGCATAATAATTCAGCATACAACTAAAA
GAGGTATTTTAGAAATGCTTATCCTGAAAGATGCAATAGGCATTTAGCATAATACCTACT
TAAAATAATTTTATCAATGACTTAATGAAACAAAACATGACAAGTAATGATGACTAACAG
TAGGTATTTGTGGTTGCAGATTTTTAGTTAATATAAGAGAGAAAAAAATAACACATATCA
AATAAATAGTTTTCTGTCTTGTACATTTAGAGAATGTGAGCTTGTTTCAGATGCACGAAG
ATGGCTTTGAATTTCACATAATGCAAAGATAATGATCTACATATTCTAGCCAGGACAATC
TAGGCAGTTTTAAATAGACATAACCAACATTTGAGCCAGCATAAATAATCAGATATAAAG
CAACATGAATTTTGTAAAGGGAAATTAGAAGATGGTATAGAAAAATGTAGAATTATTAAC
TGAAAAGGAAAAATCCAAGTTACTCACAGTCATTTGAAAACATGAAAGTGGCTTGACATT
AGGTAGGTGAAAGGTGTTTAGTTGTGACAATAGCTGTTGAATGAACATCTACTTATTTAA
GGCGATGGGCTGAACTTAGAAAGTTGTCTTCTGATTCTCACAGCTGTCAGCAATCAATGA
AATAGTTACTGATTCCGTTTAATGTAAGAAAAAAGCCAAGAAGGCTTATGTGAGCTTCTA
GGAGTTCAGATAGTTAGTGACAGAGCTGGGATTCTGAACCCTGGTTTGCCTAAGTCTAAA
TTCACATTTCCTCCCCCTGAAGCTGGCCCATGTATACAGTAACCATGCAAAGTAAATGAA
GCAGTAAACTCTGAGATGTTTTAGATCTACTAGCCACTACTTCCAGCAAGCTGCTTTTTT
CGGCACTGAGCATGTGGTACCAACCCTTGCTCTGCTGCCTACAGCACTGGCAAGTGACCC
ATTGGGCTTCTCCTTGACCAACTTGGGCATCGAGCAGTGCAAAAGTGAATCCCTCCCCAA
ATCTGGGAAAGTCATGCTGTGGACTATTCCTGCATGCAGGAGGGTACATAATTCCTAGGT
CCTTTGACCCTGCATAAGAAAAGTGACGAATGGGACAGTAAGTACAAGTCAAGCAGCTTC
GTAACCTGTGTTCACCAGGTTAATAGCAGGTACCCAATAAATTTCATAGTTATTATGTTA
CTATCACCATTATTACTAGCTCTGTAGCTATAGGAAATTTATATTAACCCCTCATAGACT
ATGTGCTCTAGTCTGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved