Erinaceus_europaeus Locus Mono:236:SNORA42
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:236:SNORA42
Erinaceus_europaeus
Mono:236:SNORA42
scaffold_232169
SNORA42
1001..1136
2136
CTGTTTAGTATGACTTAATAGGTTATTTTGGAGGTCTAGAGATGGGAAAATGTTTTCCA
TGTGAATTCCTGATAATAACATTCTGAACCCTCCCAAATAAATCACCAAGTCAAATCAAA
CGAGCATGACACCTGTACTTCAAACTTCTGGCCCTAGTTATGTCTTTTAGTGTTTATGCC
ATAGTCAGTTTTGTTATAGGTTGTAGTGTGTTAAAGTTTATACTGGGCACACAATCAATT
ATATATCCCCCCCCTTTTTTTTAAACCAGAATACTGCTCAACTCTGGTTTATCGTGGTGC
AAGGGATTGAACCTGGGGCTTCAGGTTCAATAATAAATTATTTTAAAATAATTCAGCCTT
TAAAATATTTATTCCCATTTGTTGCCCTGGTTGTTTTATTCTTGTAGTTATTATTGTTGT
TGTTGGCTAGGACAGAGAGAAATGGAAAGGGGGAAAGACAGACACCTGCAGACTGGCTTC
ACCACCTGTGAAGCAACTCCCCTGCAAGTGGGCAGTGGGGGCTCAAACCTGGAGCCTTAA
GCTGGTCCTTGTGCTTTGCACCATGTGCACTTAGCCCATTGTGCTACCACCTAACCCCCT
AATTCAGTCTTTAGTAGTTATTACTCTAGTTCATGTGCCTACCAGGGAAGTTGCAGATTT
TAGGTAGAAGAGCTACATGATGTGACAAAACAGTTGAATGGTATCACTCTGAGAGAGCAG
CTTGTAGAGCCTGATTAAAGGATATTGTTAAGTCATTCAGGCTAGAGGTGGTGGTATGGA
CCAAGGTGGTGGCCGTGGGGTTAGTGAGAAGTGTTAGATTTTGAATGTGTTGTAGGTATT
TGATGCACTGGATTTGGGAAGTAAATACATATTCAAGAATGATACCAAAGTTTTTGCCCT
ACAAGTTCTGCAAGAAATGGGGGAAACTTACATCAGTTTTCATCCTTTTCTTTCAAATCT
GAAATCACTTTGGGGCTCCAACTTTAAAATTAGTTTCTTAAGCATGCTGATGGATTTATG
GCAGGCCCTTCTTTGTGAACTTCTCATGGTGTACCCATGTCAGAGTCAGTTGCAGCTTTA
AACCAATAACCAGTTCACCTCTTACTGTGGATGACCGCTGAATGGGGCTGTATAGTTGAA
ACAGGAAATAAAAAAGTTCTTAGGGGCCAGGTGGTGGCATGCCTATTAGAATGCACATGC
TACTGCTACTTTACACAAGGACCTTAGTTCAAGCTGCAGGTAACTACTTGAAAGGGGCAG
CTTCACAAGCAATGAAGCAAAGTGCTGTAGATGTCTCTTTTCTCTCCCATTCTGACTCCT
CTCAATCTGTCTCTATCAAATGAGTGAATAAATAATAAAAAAGAAAAGTTCTTGATCTAT
AAAACTCTATATTTCTGAAGGAGAGTTTTTATTGACTTTTTCTAGGGATGGGGCCATACA
TTCTTTTCTTTCTTTTTTAAAAATGTTTCACTTTTGTTGCCCTTGTTTTATTGTTGTAGT
TATTATTGCTGTTATTGATATCGTCGTTGTTGGATAGGTTGTTGGATAGGACAGAGAGAA
ATGGAGAGCGGAGGGGAAGACAGAGAGGGGGGAGAAAGATAGACACCTGCAGACCGAATT
CACTGCTTGTGAAGTGATGCACCTGCAGGTGGGGAGCCGGGGGGCTCAAACTGGGATCCT
TCTGCCGGTCCTTGGGCTTTGTGCCACGTGCGCTTAACCCACTGCGCTACCGCCAGACTC
CCTCTTTTTAATTAATTAATTAATTAATTTACATTTAATTTTTAGAGAAATACAGAGAGA
CAGAAATACCAGAGCTCTGGCTAAAGGTGGTGCAGAGGACTGAACCTGGGACTTCCGGAG
CCTCAGGCATGAGAGTCTCTTTGCATAATTATTATGTTATCTAGCCCCCGCCCCCATTCT
TGTTTAGGGGCCACCACTTGGTCCCTAAGAACATGTCTTATAGTTTCTGTTTTGAAGATC
AGATATTCTAAATAATGTAATGCTGCAGCTATTTTCTGGAATCAGGTCTTCCCTATGTTG
CAGTGCCCCATAACTCCTGTTTGTTGTCATTTCTGTTCAATGATTTTTTTTCTGAATTTT
TATGGAGTCTTTGTTGTATGTGGGCACTGAGGTCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved