Erinaceus_europaeus Locus Mono:480:SNORA3
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:480:SNORA3
Erinaceus_europaeus
Mono:480:SNORA3
GeneScaffold_6711
SNORA3
1001..1130
2130
TTGATTAAATTTCTAGACCCACACTAATTATGTCCCATTGGTTTCTATAGTGTAACAAG
AAAGCCAAGCATAGTGACATCGTTGTCCTTTATGCCCGAACCCTGACAGCTTTGGACACT
AGTGAACATGAACGCATGAAAAGGTAGGAAGATAGCATAATGGTTATGCAAAGAGAGTCT
CATGCCTGAGGCTACAAAGGCCCAGGTTCAGTCTCCTAGACCAGAGCTGTGCAGTGCTCT
GGAGGAAAAAAAAATAAAGAAAGAAAGAAAAGGTAGGTGATAAGAGTATTTCTAACTGGA
ATCTTCCCTTTGGTTCTTTGTGGGCATATCTGAAGAGTCATTTATCTTTTTTTTTTTTCT
TTTTTGCCTCCGGGGTTATTGCTGGGGCCCAGTGCCTGCACCACAAATCCACTGCTCCTA
GAGGCTATTTTTCCCCCCTTTTGTTAACCCTTGTTATGGTTATTATTGTTGTTATTGATG
TTGTTGGATAGACAGAAATCGAGAGATGGGGAAGTCGGGGAGAGAAAGATAGACACCTGC
AGACTTGCTTAACTACTTGTGAAGCAACTCCCCAACAGGTGGGGAGCTGGGGGCTCGAAC
CAGGATCCTTACGCCAGTCCTTGCACTTTGCGTCATGTGTACTTAACTCACTGAGCTACT
GCCCAGCTCCCACTTTTGAATTTTTAAAAAATAAATATTTTTTAAATTATATATGATAGT
TTCATAAGCAGAAAGGAGAGAGAAGCAAGTCAAAGCATCACTTCAGTGTATGCAGTACGT
TTTCTGAAGGTGACCTGAAAGATAGAATCTCTCTATAGCATTAAAAAAAAAAATAGGGGC
CAGTGGTAATGTAGACATAGTGCTAAGGACAAGTGCTAGCTGAAGGATCCCAGTTCGAGC
CCTTGGATCCCCATATGCAGGGCGTTGGCTTCACAAGCAGTGAAGCAGGTTGTGAAGATG
CCTGTCTGAAAATGTACTAATGCACAAGAAAGCAGAGTTGAATCGAGACTAGAGTCATGC
TTCGGTATCACTTGTTGCCTTAGTGTGCTAGAGTCCTCGAATAGTAACTGCTAACCTTAT
TCACTGGCTGTGGCCCTCATGGCACAGTCAGCCACCAGGTTAGTTACATATGTTACTGTT
ATGACATATACTAAAATGTTCACAAATTAGAGATGGTATGCCTGTCTGTAGTTTGACTAT
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved