Erinaceus_europaeus Locus Mono:74:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:74:SNORA26
Erinaceus_europaeus
Mono:74:SNORA26
scaffold_338337
SNORA26
1001..1121
1548
GTTTGTTATGCTTTATATTCTTAATACTTTTCCGCCATCAAGTTTCAGATGACACCAAA
ATAACTTCTTCTGCCGAAGAACCCTACCAATGTGTCCAACCCTACTAGAGAAAGATGGGA
ACAGGCTGGGGTATGGATCAACCTATCAATGCCTATGTCAAGCAGAGAAGCAATTACAGA
AGCCTGGCTTCCTACCTTCTGCACCTCATAAAAGGTCTCTGGTTCACACTCCCAGAGGGA
TAAAGAATAGGAAGCCTTCCAATGGAGGGAAAAGGATACAGAACTCTGGTGATGGGAATT
GTATGGAATTGTATTCTCCTCTTATCACACAATCATGTCAATAACTATTAAATCACTAAT
TTAAAAAATGGTGGAAATGATGGTGACAGAATTCTATGCTGAAAGGGTCTCTCATGAGAC
CTTTTCCTGTGACCTTTGAAGGTTAATGCAACGTTTAAGAGACTAACATAGAAGAATAAA
GTAAGTCTTCACAAAATCCAGGGAAGAGATTACAAAACTCTTCTTTGGATCCTGTCTGGG
ATCATTGTTTAAAGAAAAGAAAACACTCATGAAATTTATTCATTTATGTAAAATGTGCTT
CTAACTCATAAAATATGAGTGAAAAACAAAAGGAGGTACTTGAGTCTATATATGCAGAGC
CTCAACCTGTACCTTGATAGATCATCTATCATTTCCTATTCAGTGCCTAAAGAAATATAA
AATTACTGGCAGGTCTCCTGACTCCCTTTTTCATCTTTTTAATATTCAATATATTTATGT
CTATCTAATTCACTTTTCTAAAGTGCTACTTTATGTTATTCCTTTATTGAGAAGTCTATA
ACTCTCCCTGACATGAAAAAAAAAGCTTTTAATTTAGAATCAAAGACCTCCATAATTTAT
TTGGCACTTGGAGAGTTTTGTCTGCCCAGGGCCCCCCAGTAAAGCCACTGTTCCACCGTA
ACTGCTGACTCACTGAATTTGACCCTGAACTACAGCACAAGTGTTGGCTTTTACTGATTT
CTCTGCCTGCAGGGGATGTACCAGATAGTTTCTACCAGACACATTTCTGTAACATTCAGC
CAAGTTTATATGTCAGACTTCAGATGTTCCTTAGATCTCTTGAGTGTTTCCCTTTTTAAA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved