Erinaceus_europaeus Locus Mono:100:SNORA48
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:100:SNORA48
Erinaceus_europaeus
Mono:100:SNORA48
scaffold_240954
SNORA48
1001..1133
2102
TTTAGAAATAAAATTATTTAGGGCGGGGGTAGATAGCGGTAATAGTTATGCAAAGAGGT
TCTATTCCTGAGGCTCTGGAGTAATCTGGGGGCTAGGCAGTGGTACACCTGGAGACTCAT
GTATGCGATTTCAGTGTTTTCTGATTGGGGGTGGGGGGGAGGCACCACAGCTCCACATGT
TCCCCTTGTGGTGGTCACTTTTTTTTTTTTTTTGCCTCCAAGGTTATTGCCATGGCTCGG
TGCCTGCACCACAAATCCACTGCTCCTGGAGACCTTTTTTTTTTTTTTTTCCCTCCTCCA
GGGTTATTGCTGGGCTCAGTGCCTGCACCATGAATCCACCGCTCCTGGAGGCCATTTTTT
CCCCCTTTTGTTGCCCTTGTTGTAGCTTCGTTGTGGTTATTACTATTGCCCTTGTTGACG
CAATTCGTTGTTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGAAAGACAGAGAAGGGG
AGAGAAAGATAGACACCTGCAGACCTGCTTCACCGCCTGTGAAGCGACTCCCCTGCAAGT
GGGGAGCCAAGGGCTCCAACTGAGATCCTTATGTGTAGGTCCTTGAGCTTCGCACATGCA
CTTAACCCTCTGCGCTATCACCAGACTCACGTAGTAATGACTCCTATGTGTTGTTGGTGC
TAACACCAGGCAAGGCATGAGCTCTATTGGGTGAGCTGTCACTCTGCTTCCCTATTGATG
GATATCATAGAGAACACAAATATAATTTCATTCTTACTGATTTTTTTCTCATGTCTTTAA
ATTCTATCACCCAAGTTTCTTTAGGTCTTTCATGAACTGAAGAACACTGTCTCATGTTAC
CCTGTCTTTGTAGAATTACCTCTTAAATTCTTGTCACCACTGTGTGGGTTTTGGAAGGAA
GCAGTCTGTAGCCCTGTGGTCTTTCTTACCTTAAAGCCAAATCCATCCAATCATGAAAAA
ATAATAATAATGTCCCTGTCCTGGGTAGGGTGGCATCTATCTGGTGGTGTCCATTTCATA
TCAGCCAGAGACAAAGCAATTCCTTGTTTATCCCCTTGGCTTTAGGCCTATGCCCATGTT
TGATTCATGCCTTGGATATATAGACTAAAAAAAAATAAATTCCAATAGAGGGCATCCACA
ATGTATCTGACTAGTACTCTTCCAAAATAGTCATCAGAGTACAAGAAATTGTCACAGTAA
AAAAGCAACCTTAGCAGACATAACAAAAAATGTAATGTGGTTTCCTGGAGGAGACTCTGG
AGCACAAAGATACTAAGAAAAAGCTAGAGAAATGTGAATAAAGTATGTGAATTTTTTGGT
TCATGAATTGTAACACCTATATCATCCTAATGTGAGAGCTTATAAGGAAAACCAGCACTG
GGTTTGTGGGAACTCTGTACTATATATTGTTAAGTGGTTGGCAAAAGAGTGCACTTGGAT
TGTGTGCTGCTTTGCAATGTGCAAGACCTAGGCTAGAGTTCAGTCCCTATGACATTGAAG
GAAGTTTTGGTACTGTAGTTGCTTTCACTCTCTGCCTAAAGAGAAAAAGAGGTGTTTGTT
CTAAAAAGTAGTTTATTTGAAATATTTCTGTAAACCCAAATAACATTGGCAGTTCAATCT
ATTTACAGAGAAAACAGGACTGGTTTGTGGCTGGTACTGTGGATAACACTGAGAATTCAT
CTCAAAATTCTACTTGGGGGGCCAGGCACTGGGTANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved