Erinaceus_europaeus Locus Mono:104:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:104:SNORA26
Erinaceus_europaeus
Mono:104:SNORA26
scaffold_239604
SNORA26
1001..1116
2116
CAGACTGAATAAGTTTGTGTGGGCACACCATGGAATACTATTCTGCAATTAAAAATGAT
GATATTGTGTCCTATGGGACAATATGGATGGAACTGGAGGTGCCTTTTACTTAGTGATGT
AAGGAAATGAAATACAATAACTAGATGGTTTCACTCGTATGTGGAATATAGTGAATTGAA
GTGGGAATTTGGAAAAAAAAGTGAACAAACTGCCTCAAAGACTAAATTTATGAGAGCTAA
TGTGCTTATTGTGGCAGGGTGAAGGAGACACAGAGCTTTGGTTTGGATGGGCTGGAACTA
TATCACTGTACTCTTGTTCATCTGTTAATTTATTTGAACAGAGACAGAGATAAATCAAGA
TGAAAAGGGGAGATAGAGAAGGAGATAGAGTGGGCCAGATGGTGGTGCACTTGGTTGAAC
TTACATATTCAAACCCCCAGTCCTCACCTGCAGGGGGAAAGCTTCCTAATTAGTAAAGCC
ATGTTGCAGGTGTCTCTCTGCCTCTCCCCCCTCTATCACCCTTCCTCTCAATTTCTAGCT
ACCTCTATCAACTAAATAAAGATAATAACAAATTTTAAAAAGAGTATTTAAAAATCAATG
TTCTGCTTTGTCTTACAAATGACTAAAGGTCTTCTTCCTAATTCCCCACAGGGTATTGCT
AATACTACCAATTGAAACCCTAGCAACAGTTGCTGGGGAGGTCCGTACCATTCCTGGACC
CTTTTGCCTTTCTCCACCCCTTTCCTAACCATGTATGGTATTGTCAAGCCACTTCCGTTT
CTATCTTGCTCCTTCTGTGTTCTGACCTGGAGAAGTGCGCGGGCAGACCAGGAGGCTGAC
ACAGGCCACTGTGGTTTGTGCCACGTGGTTTAAGCAGGTGTGCTACTGCCTTAATCTGGG
GCGCTCGAATGAATAAAGATTTGAATTGCCTTGCCGCCACAGGCTTGGTTCCTGGGTCAT
CTCTCTCCCTCGCATCGCTAGCCCAACACTCACCCTTTCCTATGCCCTTTTAAGGCTTTA
ATTTAAGAAGTTAACATAGAAGGGTAAAGTAAGTTTTCATAAAACCCAGTGGAGAGATTG
TGGAACTCTTCTTTGGATCCTGTCTGGAGTTACAGTTCAAAATTACAAGTCCTCTGCTCC
AACACACTGAGCTATCTTCACCCTCCCCCAGCCAGTATCTGAGTATTTTATTTATTTAGC
CAGAGCACCACTTGGCTCTGGTTTATGGTGGTGTGAGAGATTGAACCTGTGACTCTGGAC
CCTTAGGCATGAAATTCTTTTGCAGGGCCATCATGCTATCTCCCTCTGCCTTATCTGAGG
CTTTAAAGCCAGCAGACACAACCCTCCACTGATGAAGCCCCCCTCAGCAGGTGGGAAGAG
GGGCTTGAATCCATGTCTTTCCACATGGAAACTGGGGGCACCCCCTCCCAGCTCCTAATC
CCTCCATTTTTTACAAAGTTGGAGCTCCTCCACCTGTGTTGAGCTTCTCCTAGTTCTGGA
AGCGTGGGTGTTGTGAGCGCTTTACCACGTTTCCAATTCAATTTCTTTCATTAAATGGTA
GTTCTCTCAGTGATGAAGATCTGTATTTTTCTTTCTTTTTTTTTTTTTAAGATACCAGAG
GCAGCAAGGGGGAAATTGCATAACAGCCGCTGAGAAGCAAAGCAGCTGCTATTAATTCAT
GTTGGCTTGTTCAAGTACAAATGTGCATCATCTGCTTCAGAAGGGAGAGCATCTCCTGGC
CACGCTTGATCGAGGAAGCAGGGAGCAGGGCCTCTGTCCAAAGCAGCCAGAGAGTCAGAA
GCAGGAAGAGCAAAGAAGCCTCTAGAAGCAGAAGTAAGCCCCATATCAGAGGTGATGCTC
CTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTCTTTCTT
TCTTTCCTTCCTTCATTCCTTCCTTCCTTTCATTCCTCTTCCTCCTCCTCTTTCTGTCTT
TTTCTCTCTCCTCTTCCATCTTTCTCTTTCCTTCTTTCCTCCCTTTCTTTCTTCTCTCTC
CCCACTTTCTTTCTTGTTTGTTTGCTTTTTTCTCACTATCTTTTCCTTTCTTTCTTTTTC
TAACAGTGGCTTTATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved