Erinaceus_europaeus Locus Mono:320:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:320:SNORA70
Erinaceus_europaeus
Mono:320:SNORA70
scaffold_298405
SNORA70
1001..1134
1413
AGTCCTGTGAAGCAACTCTTCAGCAAGGCAACTCACTAGATCACCCACATGCACTGACT
CCACTCATTCATAATTTAATTTTAATAATATTATAAACATTTAAAGATTTGTGTATCTTG
CTCACTTTTTTTTCTCTTTTCTCTTTTGCATTCTAAGATATAAAGTCTACTAAGGAAGAA
TTTTTCTTCTGTCCTACTTGTTAAATTCCCTTCTACCTGGCTAGAGTAGTACCTAGCATT
TAAGTAAACATTTAAATAGCATTTTAAAAGTTGATTATTTCTGCAGCCAATTAAGCTGAC
TGAGCTGCCCGCCTGGTGGTGCCTGGTATGCAGTGGCTGCAAACAGCAGCCTCCTGGATG
GTGTCTGCAGCCCATTATTTGTACAATCTGCCCTAAGGGACACTGGGGAAACCCTACCTA
GTCAGTATCCACTCCATGCCTGACCCCCTGCTGTCCCTAATCTTAGGCTCCAAAACAGGG
ATGCAAGTGCCTTTGGGTAGCCCCAGGGCACAATGGCCAGGTCCAGGTCATCATATCCAT
CTTCACCAAGCTTCAGAATAAGAAGCATGGGATAAAGGCCCTATGCAAGGCTAAGTTCAA
GTTCCTTGGATGCCAAAAGATCCACTTCTCCAAGAAGTGGGGCTTCACCAAGTTTAGTGC
AGATAAATTTGGAGATATGGTGTCTGAAAAGCACCTCATCCCAGATGGCCATGGAGTGAA
ATATATCCCCTAGACAAGTGATGGGGTTCTGTACTCCCAAGAGCCTCAGAGATGCCCCAT
CAATCAATTACAATAAAGCAACATCCCACCTAAAATATGTTAATTTATTGTTTATAATAG
CAAGATGATATAGTAGAGAATTCTAAAACAACTGAATTCCAGAAGATGTCAAGAGATGCA
TGCTTGTTCTGTCAAGGTCCGGATAAACTTTGCTAGCCACGCAACTACTGTTTCACAATA
CAATGGTTCCACCATTGTAGTGCAAAGAACACCCACAGACATTGTCAACAAATGGACTTA
AGTGTGTTACAACAAAAAGTGTTTATTTTTAAATTATTCTGTATTCTGCTGAAGATGTTG
CTAGGGTTTGAACCAAGAGTCTCCTACATGAAAAAAAAATTGCTCTGCTACTAAACTACA
TCCTCGACTACAATAAATTTTACTTACAAAAGCTGGTCACAAGATTTGAAGTGGCAACAT
TGTAAAATAATCCTTGTTCATAAGAAGATTGTCAGAGGAGCTTAGGGTCTTAACAGCAAG
TCTTTCTTTCTTTCTTTCTTCTTCTTTCTTTCTTTCTTTCTTTCTCTCTCTCTCTCTCTC
CTCCTTCCATCCTTCCGTCCTTCCTTTCTTTCTTTCTTTATTTCTTTATCATTTATGAGA
GAGAGCCAGAGACACCTGGCACATGTGATGCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved