Erinaceus_europaeus Locus Mono:386:SNORA66
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:386:SNORA66
Erinaceus_europaeus
Mono:386:SNORA66
scaffold_365930
SNORA66
1001..1130
2130
GGGGTAAGCAGGAGGGTTCAGGTCCTTTAACATGATGTCAGAGTACCTAGAGGATGGTG
AATTGTTATGTAGAATACTGAGAATTAGTATGCATGTACATACTATTGTATTTTTTGGTT
ACTGTATTTTATTGACTTTAAACCATTAATCCCCCCACACCAGTAAAAGAGAAAATTAAA
CACTGAAATACTGTTTTTACAAAACACATGGTCAGAGACTGACATTATATTTTAACTGCT
TTGAGAAGAAATGATCTCTTCTTAGAGTTTTTTATGATTATCATAGGTTTTTATTTTGTT
CACTTGTAACTTTGTTTATTTATTAGTGATTTAATATTTTACAAATCATAAGGTCACAGG
GGTTCAGTTCCACACAGTTCCCACCACCAGAGTTCTGGGTCCCAACTCCCTCCATTTCAA
GTGTAGGACTTACTCTCTGCCTTAATCCAGCTTTCTAGAACTATTCTCAACTCTGACACC
ATTTTTCTCAGAAAATATGTTTAATCTGCCTTCCATGTTAGCTATAAGTTACTAAAATCA
TGGCCCCATGACTTTAGGGACATACCTAAAATAGACTTCCTAGCTTCTTTTCATCCTAAG
ATTTTTCATCTTCCCTACTCTATTGCTGCTTCTTGATTCCTGTTTATTAAACATTTTGTC
CTGCTTTTTTTATTTTTGTCCTTACTGCCTTTTAGCCACCAAGTTGCAGATGTTACTATG
ATTCTATCCTGACTTCCCTGGGCTGATGACTTCACCATTGTATCCTGGAACCTCACCTCT
CCAGAGCCCTACCCCACTAGGGAAAGATAGAAACAAGCTGGGGGTATGGACTTTTTAGAG
ATTTTAATACGTACTTGATAAATTTTTTTTTTACTTTTAATTCATTAGGAATTTACACCT
TGATCAATATATGATTTATTCATATGTACTTACTACCAAAATTCAATCATCTATAATTTT
TATATTAGTTAAAGCTGTGAATAATTGAAGAGTTTAAGTATATATAAACTCAATCACTAA
CTGTGCGATGTGGCAGAACGAGGGGAACCAGGTTTACTAAAGTAATTGTAATGATAGAAA
TGTATTAGCCTCTGAAACTCCTGAGGTGGTCCATTCTATCCTAGTATAGTAACTATCAGT
TAACTCTTAAGAGTTAAATAAACAGAATCATTTACTTTGATAATTTTTTCACATTATGAT
CTTTGAAACAGAGGATAAGGTTTAATGAGTAGCTAGACATTAACAAGGGCAGGTATTATA
GAACTTGGAACATTTGATCTCCCTCTTAAGTATGTAATATTGCTTCCAGCTACACACACA
CACACACACACACCAAAAAAAAAGACAAATTTAAGGATAACATTAAAGGCAAAATGATTA
GCAACTAATTTTTCTTAGTTTTGAACTTTCTCATTTAATGCACACAAATGAAAATTGTAT
TGATATATACTGACACTTGAAATTAATTTCACCTGGAATGTTAGGTGGAAAAAAATAAGC
AGATTAAAATAAAATACTTAATACACTTTTTGCCCCGGCCAGCAGGGCGGTGAGCAGGGG
CTAGGAACCCAATGAGACCTGAAATGATAGGGACAAGAGACGCGAAGAACGAGAGCAAGT
CAAGTTTCTGATCAAGCTCTAAATTTTATTGTGTGCACAGACATTATAAGGCTTTGGGGA
AGGAGGGGGGAAGTGCTAGAGGAGGAGGAGGGGGAGCAATCTTCAAAGGGGGAATGTTCC
TTGCAACATACAATGGATGAAATCATGTTTGCTACCACAACTGTGTGTTGTGTCACTGTT
TCTGATAAATGGTCTACCTGAGGGGAAAATGGCCTGCCCAGGGGGAAATGAAACTTGTCT
CGAGGACTTCCATAGTTTCAAAGCTTATCATCTATCAAGCAGAGAAATGGCTCCTGGCAT
CTCATCCCTTCGTTATAATTTAACTTGAGGCAGTTAGTTGAGGTGAGGAGCAGGGACCTG
AACAGCAGGTATAACCAGAGGGGGGAAGTATTGACCCGATTCCTCCCGTGGGGTGGGTGC
AGAAACCAACCTTCCCGCATCTTATAAGGCTCTCGGTGTCTTTTTGAGGAGGGGAGGCAG
AGCCACAGTTTCCAGGGAAATGATTTTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved