Erinaceus_europaeus Locus Mono:361:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:361:SNORA70
Erinaceus_europaeus
Mono:361:SNORA70
scaffold_230735
SNORA70
1001..1120
2120
GTGTTTGTTCTTTACCTCAGCTGACTGCCAACTCTGTTTCCAAGAGTCTGGAACAGAGA
AGTTCAGTGTAGGTGTAGGGGACCAGATTGGGTGACGAGACGTCAAGTGTTGGACAGGGT
GGGCGAAGATATCCGTGTATATTGGCAGGTCCGGTCGAGCGTAGACGTGGGAAATGAACT
TAGATGATGCTGCATCCCGACGAATATCTGGCGGGGCGATGTTGCTAAGAACTGGCAGCC
ATGGAACTGGGGTGGAACGGATGGTTCCAGAAATTATCCTCATGGAGGAATATAATTTGG
AATCGACCAAGTGGACATGGGGGCTACGGAACCATCCTGGGGCACAGTATTCTGCAGTGG
AATAGCATAATGCAAGAGATGATGATCGTAGTGTGGAAGCGCTCGCGCCCCATGAGGAGC
TGGCCAGTCTTGCAATGATGTTATTCCTCGCGCCCACCTTTGCTGCAGTTTTTATGAGAT
GTTCGTGAAATGACAGAGTGCGATCGAGAGTAACGCCAAGATAGACTGGCTGGGCTTCAT
GCCGGATTCTCGTATCGCCAAGCTGCACATTAAGCTCATGCGAGGCCGAGGCATGGTGTA
GATGGAAAACAGATGATACCGTTTTTGCAGTGCTAGGGATTAGTCGCCATTTTTTACAGT
AATCAGATATCAGAGACATGTCTTTCGTGAGTGTTTCCTCGAGGATGTCGAACTTTGATG
CCTGAGTTGCACAGCGGATGTCATCGGCGTAGATGAACTTCCTTGAAGAAGTTTCTGGGA
GGTCATTGATGTAAATATTAAATAGCATAGGAGCCAGAACAGAGCTAGTGGTAAAGCAGG
GTGGCAGGTGTCTATCTCCCTCCTTCCCTCTCAATTTCTGACTGTTTCTATCCAATAAAG
ATAATAAAAAAAAATTTTTTTTAAGTCAGAAAGAAGGACCAATTGATTACTAGAGGCCAA
CTGTGCTGATTCTACCTCAGCTTTAGAAAATAAGGGGTAGCCTACAGCCAATTAAGCTGA
CAGTGGCGCCCCCTGTGCAGTGGCTGCAAACAGCAGCCTCCTGGGTAGTGTTTGCAGCCT
GTTGCTTGTATAGGCTGCCCTAAGGGACCCTGGAGACAGCCCTTCCTACTCTGTTCATTT
TATGCCTGACCTCCTGCTGTCCCTAACTTTAGGCTCCAGACAGGGATGTGAGGTGCTTTT
GGGAAGCCCCGGGGCACCGTGGCCAGTGTCCACATTGGCCAGGTCATCATGTCCATCTGC
AACAAGCTGCAGAACAAAGAGCATGTGATCGAGGCCCTGCGCAGGGCCAAGTTCAAATTC
CCTGGATGCCAGAAGATCCACATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved