Erinaceus_europaeus Locus Mono:354:SNORA63
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:354:SNORA63
Erinaceus_europaeus
Mono:354:SNORA63
scaffold_349398
SNORA63
1001..1126
2126
ACCTAAAATGACAACAGAAGAAAGTTCCCTTTATTTTTATTATCATGCTGACATTAGCT
AGTTGGCCTAAGTGGAGATCAGCTGGCTATAAACTAGACCAGCTTGGTTACCTATTTGGA
GCCTGATACTGTGAAAGATTTTAGTATTAGATAAAAGAGAGGTCATCCTCTCAAGACGTT
TACACTCAACCTGGGAAAATGGTAATGAACAGTAAGAAACAAACTGAGAACTTCCTGCTC
ATTTCATAAGAACTGGGTACTACTTAAATGCTCCACAGTGTCTTGCAAGAGTACAACCAG
GGTCTGAGACCTAGTACCACATGGAAGTGCCATGGACAGTCTGGGGGAAGTTCCGATGTA
GGGTGTCTCTTCCTCTCTCTTTCTCTTTATCGCCCTCTTCTCTTTTTTCCTTCTTCTCTT
TCTCTTTCTCTCCCTCCCTGCCTCTACGCTGTCTCCTTCTCCCTCTATCTGAATGAACAA
ATCAGCCTGAGAATAATGAAATCACTCATATGCAAGGCCCTGGCTCCATTAAAAAAAAAA
AAAGGAAGGAAGGAAGAAGAATAGAGTGAGTAGACAATGGGTTGGAATACTGATATTCAA
AAGAAGGAGAAAGGATAAAGTTTACACATATAAAAGGGTTTTTAAGGTGGAATAGTATAG
ATTAAGTCCATTCTGTTGACTTGGAGTTGATGCATCTGCCATTCTTCTACCTGCTTCCCA
GCTCCCCAAACTGATTGTTTTTGTCTCTATTTCCCTCCACAAACACTCCCTTCCTTCCTT
CCTTCCATCCTCCCTTCCTTCCTTCCTTTCCCTCTCCCTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCTTTCTTTCATACCAGTGAATGAATCCAT
CCATACCCTCATGAATTTGTGATACTGCTGAGTATTTGTGATACTCCTCTCCTTTTTTAA
AGAGTTGTATTAACAATTTCATTGTCCTAAAACTTATTCTAAAGCAGGATTTAGACTACA
ATATAGCTGTCTGTGCTGTGTTGTTGTTCCTCCTGCTGAAAAACAAAGCGTTTCTCTACT
ATACCTGTCTGCTTTATCCTGTAGCAGAGATGCTTGGTCTCATACATACTGATTAAAAAA
AAAAAACTTATTCTACCATGAATATTATAACTTATCATCTGTATTCTTAAAAAAAAAAGA
TTTACTTATTTGAGAGAGAGAACAAAACAAAACAGAACACCAGAGCATCACTCTGGCATA
TGCAGTGCTGCGGCTCAAGTCGGAACTTCACATGTGTGAGTTTGGTGCTCCGCCATTGCA
CCTTCTCCCGGACCACTTTTCTTTATGCACATTTATTTATTTATTTATTTATTTATTTGC
TTGTTGGTTTGTTTGAGGGAAAGAGGGAGTAAATTAGAACATCACTCTGGCACATGAAGT
GTTGGGTATTGAACTTAAAACCTGACGCTTTGAGGATCCAATGTCATATCCATGGTACGA
CGTCCCTGGCTGCATGATTTTGTTTTGCTTTATTTTATTTTATCTTATCGTGAAGGGATA
AGCTTGTTATTTTTTATTAATTAAAATCATTAGTGATTTATAATGATCAATAAGATTATA
TTTAATAATAATGATCAATAAGATTATAAGATAACAGGGATACAATTCCCACCACCAGAG
TTTCATGACTCATCCCTCTATTGGAAACTTCCTTATTCTTTTATCCCTCTGGGAGTATGG
ACCAAATTCTTTTTTTTTTAAGTTTTTTCTTTCATTTATGTATTCTCTTTTGTTGCCCTT
GTTGTTTTATTGTAGTTATTATTGTTGTTATTGTTATTGATGTCGTCATTGTTAGATAGG
ACAAAGAGAAATGGAGAGAGGATGGGAAGACAGAGAAGGGGGAGAGAAAGATAGACACCT
GCAGACCTGCTTCACCGCCTGTGAAGTGACTCCCCAGCAGGTGGGGAGCCGAGGGCTCGA
ACTGGGATCCTTAAGCAGGTCCTTTGGCAGGTCCTTGCGCTTTTCGCCAAATGCGCTTAA
CCCGCTGTGCTACCTCCCGACTCCCGGACCAAATTCTTTATGGAGTGCAGAAGGTGGGAG
GTCTGGCTTTTGGAACTGCTTCTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved