Erinaceus_europaeus Locus Mono:220:SNORD102
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:220:SNORD102
Erinaceus_europaeus
Mono:220:SNORD102
scaffold_314202
SNORD102
1001..1071
2071
TACTACGCACACATACTTAATGCCATGCATTACTAAACAAATCTACTAAATTAGTAGAT
TTATCTCTTACTGTGCCTGATAAATAGCATTTAGGAACAGTCATGAGTATAGGAAGAAAA
TTCCGAGGTAGGAATTCATATATTTAAGTCAAGGTGGGTCAAGATGGAAATAAAGTTCTT
TAAGAAATGGGCCTGGTGGGTAAGGAATCAGAAGATGGCTTGAATTAATGGTTCTGCACT
TTTGTGGTTTGCAGAGCCTTTTAAAAAAAATTTTAAGTAGTACTTAGTTCTGGCCCCTGG
TGATACGGGGAATACCTGGGGACTTTGAAACCTGAATGAATGAAGGCATGAATCTGCAAA
ACCATTATTATTGTCCCTGCCCTTGTTTAAAATTCAAATGGTAATCTGAGCACTGAAATG
TCTTCCAGTACTTAGTGGATGCAAATATGCATTTAAAATGTCTTTGTGTTCCTAGTACCA
AAGATTTGGCCTTGGTTAGGTAAACAGTCTTGGTAAAAGTATTTTGGTGAGTCGGTTTGC
TTTCAGATTATGTGATTTATAGTATTCATGAGAGAATCAGCATCACTCTGACATAGGAAA
TGAGTGATTTTGAGCGCTTATGCTTCAGAGGCCAACTTACCCCACCAGGCTACAACTTAG
ATATAAATATATCTTAGGAAACACTTCAGTACAAGAGTTCGTAATTTTTTGACAGTTTCT
GTATTCTGTCATCAAAAATAAAGTTTTAGCCCATCCTTTGAGGTGTAAGGTTACTCAGCA
GATCACATATAATTTACTGAAGGAGATGACTACTAAAATCCATAACGGCTGTGTACTTTA
ATGATTTTTTTTTTTTTTACCAGAGCACTGTTCAGGACTGGCTTATGGTAGTGTGGGGGG
TTGAACCTGGGACTCTCAGGCATGAGAGTCTCTTTGCAGAACCATTAAGCTATCTACCCC
CCACCCTTTGACCATTCTTGAACTGTATCTTGGTACCCTAGAGCTTAATGATGAGTATCT
TGTTGATGCTTAAAGCAATGTGAAAAAAGACATTTCACCGGCTCTGAAAGCTCTTCGGCT
ACCATGTAAGAAGAGAGCTCTTTTACATGATGTGGGTCCTCTGATGGGTTATATGTTTTA
ATAGGAAGAATACTGGATTGGGATCTAAAACATTGAAATATCTACATGTATTTGGAACAT
GGGATCTTATTAAGAAAGGACTAAATATCTAAAATATGCTTTTTAGCAAATGGTGGATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved