Erinaceus_europaeus Locus Mono:208:SNORA23
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:208:SNORA23
Erinaceus_europaeus
Mono:208:SNORA23
scaffold_326475
SNORA23
1001..1182
2182
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAAG
ATATACCACAGCTTCCTTCAGCACTCCTGTTGGATTCTCCCTCCCACCCCATTAAGTTTA
GAGGGAAAGAGTAACAGAGAAAGACATCATAGCACAGTTAAGTAGCGTGATTCGTGAAGC
TTCTGGTGGTAGTGCTCATGTGTATGTATTTGTGTGAGCTATCTCCGGCCTCTACTTAAA
TACATTAAAAAAATAAAATAAGCTTTTATTCTCATGAGAGAGAAACTGGGGTGGAGGTAG
ATAGCATAATGGTTATGCTACAAAGTCCCAGGTTCAATCCCTGGCACCACCGTAGACCAG
AGCTGAGCACTGCTCTGGCAAAAGAAGGGGAAAAAAAGGCTGCTGTAATGTGCGCACAGT
TTTCACCTGTGTCTGGTAGCAGTCTATCTCTGTTTTAAATTCAGATCTTGCTATCCACAC
AAGCAATATGCAGCCAGAGAGTAAGTTGGGATCATAGTACTGGTTTAGTGTTGTCTTTTC
AGACATGACTACCACTGGCCAGCCTCCAAATTCCCACACACAACTATGAAAAAAAAAAAA
TCATGGGGTGTGTGGGAGAGAGAGTTATAGCACTGCTCAGCTCTGACTTAAACCTGGGGC
CTCAGGTATAAAGTCTTACTTCCATGCTATACCTCTAGTCCCTCTTTTTTTTTTTTTTCC
TTTCTTTTTATTTATTTATTTATTTTTTATTTAAGAAAGGATTCATTAACAAAACCATAG
GGTAGGAGGGGTACAACTCCACACAATTCCCACCACCCAATCTCCATATCCCACCCCCTC
CCCCGATAGCTTTCCCATTCTCTATCCCTCTGGGAGCATGGACCCAGGGTCATTGAGGGT
TGCAGAAGGTAAAAGGTCTGGCTTCTGTAATTGCTTCCCCGCTGAACATGGGCGTTGACT
GGTCGGTCCATACTCCCAGTCTGCCTCTCTCTTTCCCTAGTAGGGTGGGTCTCTGGGAAA
GCTGAGCTCCAGGACATATTGGTGGGGTCTTCAATCCAGGGAAGTCTGGCCGGCATCCTG
ATGACACCTGGAACCTGGTGACTGAAAAGAGAGTTAACATACAAAGCCAAACAAATTGTT
GAGCAATCATGGACCCAAAGCTTGGAAAAGTGGAGAGGAAGTATTAGGGAGGTACTCACT
GCAAACTCTAGTATACTTCTGCTTTCTTACTTTGGTGCCATACTCCAAACTCAGTCAATT
TCTGCTTTGCGTTTCTACTTCTTTTTTTTTTTACATGCATAACATTCCCCAGATTCCCAT
TTAACAATACAACACATATGTCCAAGAAAGACAGTGATTTCAGGCTGATTCCTTTGGCAA
TCCCTGGTTTCTTTTACAGGAAAGGGAGGATATTCTAAGACATTACATAGATGGCGGGTG
GGGTGGAATAAGATACGTGGGTGGGTTGTCAAATATTTAAATGTCAACAGGTTCCTCAAA
CAGAAAGGACAACAGGACAATGTCTTCAGAATCTTCAGGGGGAAATAACTTCAAGCTTAG
AAATCTATTTCCATCCAACCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved