Erinaceus_europaeus Locus Mono:168:SNORD66
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:168:SNORD66
Erinaceus_europaeus
Mono:168:SNORD66
scaffold_226413
SNORD66
1001..1074
2074
GGCTTCCTTAATTGCTTCTCCGCTGAACATGGGCATTGACAGGTGGATCCATACTCCCA
GCCTGTCTCTCTCTTTCCCTAGTTCCTGGGGAAGCAGGGCTCCAGGACATGTTGGTGGGG
TCGTCTGCCCAAGGAAGTCCCGTTGGCATCATTTTAGCGTCTGGAACCTGGTGGCTGAAA
AAAAGAGTTAAAATACAGAGCCCCCCCCCCAAAAAAAAAAAAAAAAGATTGTTAACTAAT
CATGAACCTAAAGGGCTGGAATAGTTCAGATGAAGAGTTGGAGGGTCTCTGTTTTGTAGA
TGGTTCATTGTCCTTTTTGGTTATATTCCAAAGATCCCATGACTATATATGTATTTTTTT
CCTGAGCCTGACATCTGATATGCAATTGGTTCTAAGTTATTATCTGAAGAGATGATGTCA
TGGATGGAAAAAGCTGGATCATGGAAGAGAGTAGCTCCCAAATATGGGAAAGCTGTGTAA
ATATTATTGACTGTAAAGATGGAAATAGAAAAAGAAAGTGAAAGAGACCGCAGTGACTAA
GCTTCCTTCAGTAGGGGTAGGTGGTAGGGATATAGGCTTGAACCTGGGTGGTTCACAAAG
ACAAAACAGTGCACTATCCAAGTGAGCTCTTCCCCTGGCTCAGGATATTTTCTTTATGAT
CTCAAGGTACAGGAGAAATTTCTTAACCAAATGTTAACCATTAAAAAAAAATAAAGGAAA
CAACGTTAAAAGAAAATACACCCTGACAATTCTGACTACTTTAAATATAAAGTTGTTATA
ATCAAAGGAGACTTTTAAAAAGCATATTCTGTGGGTCAAGTGGTGGCACACCTGGTTAAG
TGCATACATTACAGTGCACAAGAACCAAGGTTCAAGGCCCTGGTTCCCACCTGCAAGGGG
AAAATTTCACAAGTTGTAAAGCAGGATGCCGGTGTCTCTCTATCCTCCTCTCTCTCCATC
TCCTCTCGATTTCTCTCTGTCCTATCTAAAATTATATATATTTCCACTGATGACACTTTT
AGTGCCACGTGTTTGGGCCACTGAGACCCCATGATGGAACTGAGGAGCTGAGGAAAGGAC
AAAAAGAAAAAATACACACACACACACACACACTGTTTATTGGACGGAGAGAAATTGAAA
GGGAAGGGGGACATGGAAAGAGAGACAGAGTACCTTTATCACTGCTTTACCACTTGTGAA
GTGCCCCTCAGCATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved