Erinaceus_europaeus Locus Mono:185:SNORA25
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:185:SNORA25
Erinaceus_europaeus
Mono:185:SNORA25
scaffold_267394
SNORA25
1001..1127
2127
TATGAGAATGACACACATCAAAAAGGACAGCAGCAACAAATACTGGAGAGGCTGTAGGG
ACAAAGGAACTTTTCTGCACTGCTGATGGGAATGTAAATCGGTCCAGCCTCTGTGGAGAG
CAATGTGGAGAACTCTCACAAGGCTAGACATGGACCTTCCATATGACCCAGTAATTCCTC
TCCTAGGGATATACCACAAAGCCCACTCTTACTGCATTGCTTTTTACTGAAAAATCACTT
GGGTGGGAGAGGCAGTGAACACATAGTTACCTTCACACTTCACTAAGCCAGGACTTGGGT
TCAAGCCCCTGCTCCTCACCTATAGGGGGAAAGCTACATACGTAATGAAGTAGAACTCCA
GGTGTTTCTATGTCTTTCTCCCTCTCTACCTCCCTATCTCCTCTCCATTTCTCTGTCTCT
AATAATAAAATAAAAATAAAAGAAAGACAGAAATATGTATTAATTTTTTTTAAAAAATCA
CTTGTCCCACAGTATGCAGTCTCATAATGCAACAACCTTTGCTTTGGAGTCAGAAGTCCT
TGGTTTGAGTGTAGTCAGGGTTGTTCTCTTGATAAGTTGATCGAATTATCTACTTTAAGT
TGGAATCCTCTAGTTAGAACTGTCCTATATGTGTTTCCTAACTTTCTATGTTTCCAACCA
CAAGTATTGTAGAGGATTATGTGACCACCTCTCCATCTGTCTGCTGAATGTCAGATTAGG
TCTCCTTTTGACTTCCTTCTTACTTTTTTCTCTACTTCTCATCAAGAAGTAAAACATTTC
CTGAAGTGGACCCCTACTGAGTTGACCATCTTCACTGTGGAACAGAATCCAGTCTTCAGC
AATACCATGAATGACTTTTTCCACTGCTAGACACAGCTCCAAAATCACTAGGGAGTAAAA
GGGGGACTTGACACAGTTTCTTTTTTTTTTTTCCTACAAGGGAATCCAAGGTTATACAAT
CCAGAGGTTATGGCTCTCTATGCTCCAGTAAAGATGTACCTAAGTCACTTCAAAGAGGGC
ATATGGGCTGTGAAAGCAGGACTTCTCATAGCTATGATCAAAAACTGAAGTTCTCCCTAG
GATTCGACAATATTCAATAGTGCCAAAATTTTCTGAAGAGATATAAAATATAGCCACTCA
TAAACATAATAGTTCACTCATAATAATACATGCTAGGAAAATAAATTAACCTCTCAAAAC
TAAATGCGTATTATATATGTGTAAGTATACACATACATCACTCACACCCATCACCACACA
ATAATAGTAAATAAGTAGACTATGGATCAGTCATCACAAATAGATCATTGGAACTGACAT
CAAAAGTGAAATTTTGACAGTTTTTTCTTAGTCTGCGTATTCAGTAACCTCCCAGAAGCT
CTAACAAAGGCCAAAATTATCCAGTGTACATTGAATTTTCCTGTTAGAGTAGGCCATCGA
GCAGATATGACTGACTACCTGTTGACCCACAACTGGAGAAGATACTCCTTCTTCTCTCCC
TAACCTTGAAGTGTGTATGTTCCACGCACCATTCCTACATGTGAAACAACTTCATGAAAG
CAAACTTGATAGAGTTATATATTATTGAGACCATTTTAAGTGTATATGTTACTGAACCCC
AGTGAGGTCTTCATATGAACTCTTAAGAGTCTGGAGACCTGGGGCAGAGATCTACTCATC
ATGCCACCAAAGACAAGCCACCTAACATATGAATCCTTGCTTGTTAAAACCACCACTTAT
AGATTTGGAGTGGGTTGCCCATTTCTCTAGTCTCCTCTAGGTCATAGTCCCCAGTACTGA
ACTATGGTAACTTCCAAAGTTGCAAATCAAGATAGATACCTATACCATAGTAAGACCTCC
TTAGTGATGGGTTTAAAGATTATTCAAGTCCAAATAACAGATTGGGAGAGAAGTGGTAAT
CTACAATAACCAGAAATCTGAACATTCTTTGGAACAAGTACAGATATACTTCCCCTTAAC
TATCCATCCTATGGACTCTTTTCCTTTTTATTTGACTTTTTTGTGTCCCCATTCCCTCCA
CTGGAAACTGCATTAGTTCTCCCATATCACAGATAAGGATTGACTATTATATCTATAACT
ATCTAACTATATTTGTATATATTGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved