Erinaceus_europaeus Locus Mono:83:SNORA41
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:83:SNORA41
Erinaceus_europaeus
Mono:83:SNORA41
scaffold_285519
SNORA41
1001..1135
2135
TAGCTTCACAAGAGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTGTCCCCCTCTTTAT
CTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTACCTAACAATAATGATAACAGAAAAGAT
AAACAAGGGCAACAAAAGGGGGAATAATAGCCTCTAGGAGCAGTGGATTCGTGGTGCAGA
CACCGAGCCCCAGCAATAACCCTGGAGGCAAATTAAAAACAAAATTGGGGAGGGGGCGGG
CGGTGGTGCATCTGGTTGAGCACACGTTACAGTGCGAAAGGACCTGGGTTCTAGCCCCCA
GTCCCCACCTGCAGGGGGAAAGCTTTGCAAGTGGTGAAGCAGGGCTGCAGGTGTCTCTCT
GTCTCTCTCCCTCTCTATCTCCCCCTTCCTTCTCAATTTTTGGCTGTCTCTATCCAATAA
ATAAATAAAGATAATTTAAAAAAAAAGCTTGACCATTAGCTGTATATTCTAGGAACAGGC
CATTTTCAGCATATTTTCTTAGGTGAAGTAAATTACAGCCCCTCCCCTTTTTTCTTTTAT
GGTCAGGCTTTATAAAATCTTACCAAACAGGCCTACAGTTTGTAATTCTTTCTGTAAGTA
TGGCCACAATCCCCCCTACCCCACTGTTTCTCTCTCAACACCCACCATCTGCCAAAGAAA
CATGACTGATTACTGGTTTTCTGATTCCCTTTACAATTTGTGACTGAGTTAGCAACAACA
AAAGTCATCTCATTTGCAGCTCTAAATATATCAACATTGTCAGACTGTTAAAAAAATAGT
AATGCAACCTCTGCTTTTAAATCTTTTTTTCTTAAAGGTAGAATTCATTTTTGATGTAAT
GAGGTTAATTAAACACACACATATGTGCAATATAAAAACTGCAATAGTTTGGGTTGTTGA
CTAATGTTGAAAAAGAAGAGTAGAATATTTCATAGGTCTGTATGGGTAGAGGCAGAACAC
TGATTGCATTTAAATGACCTGACATTAAAAGAAAAAAAAAATTCCACAGCTAGTGATATG
CAACTGTTCTTAAGGTAGCAGTTGTGACATTCTTCTGTGAGAAAGAAATAATGACACAAA
TTTAAATACCTCTTGCCTAGCAAAACAGAAAGTTGGCATATGTGTGACAAATAAGAAAAA
AAAAAAAATCAAAAGAGGCTAGGAACTTTTGCTGTCAAGGAGTTGGTGTGATGAGGTTCC
TTCTCTGCATCTTTTGTGATCTGATATATTAGAATGCAGACCAGGTGGCAGGCAGGCCTC
TTCTCCATTTTATCTTTTCCTGTCTCAAAGGGAGTTCCCTAGTGATACCAGGGTAAGAGG
AAGTCAGCAGCCCTGACCTTATCATTACACAGCAGGGCTCATGAAAAGATAATTAGCTCC
AACAGTTCACAGTCAAGGTTCTACCAAACTCCTTGATGACTATGAGGCCTGGTAACAGCC
ACCTGCTTCAGATGCATTTTCTCCCTCCTTACCTTTCCTTCAATCAAATGGTACTTGGAC
AGCAGCAATCAATCACCTAGGTTTTCCCAGGACAGGGGTTTTGACTGAGACACAACACTT
CCCATGGAAATAGGAAAATCATGCCCCAGGCACATAGAGCAAAGTGAAACGACCCTGCGT
GAGGATCCCGGTTCCCCACCTGCAGGATGGTCGCTTCATCAGCGGTGAAGCAGGTCTGCA
GGTATGTATCTTTCTCTCCCCCTTTCTGTCTTTCCCTCCTCTCTCAATTTCTCTGTGTCC
ATCCAACAAGAACAATAGCAGCAACAACAATAACAGCAACATCACCAACAACAAGGGAAA
AAAGATGGCTGCCAAGAGCAGTGAATTTGTAATGCAGGCCCCAAGTTCAAGCAATAACCC
TGGAGGAGAAAGAAAGAAGAAGAAGAAAGAAGAAAGAAAGAAAGAAAGAAAGGGAGAAAG
AAAGAAAGAAGAAAGAAAGAAAGAGGAAAAGAAAGGAAGAGAGAGAAAAAAACACTAGCA
AAAGAAACACCTGCAGCACTGCTTCTTCCCTACTCATGAAGCTTTCTTCCCTGCAGGTGG
GGAGTGGGGGCTCGAACTTCAGTCTTTTGCACCTGGTAATGTGTGTGCTCAACTAGTTGT
GCCACAGCCCAGCCTTTCCCCAAATAATTTTTACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved