Erinaceus_europaeus Locus Mono:141:SNORD113
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:141:SNORD113
Erinaceus_europaeus
Mono:141:SNORD113
scaffold_215280
SNORD113
1001..1077
2077
TTTGTTCTTGGAGGTGCCCCTCTGAGCTGACCTTCTGGTCTCCTCTTTACTCCTCAGAC
TGGCCACAGGCAGGTCGAGTCCTGGAGTCTCCTGTCAGTGTCTTGAGTTGTGAAGGGCGG
CCTCCCCCAGCTAGGGCCATGGAGCACCATGTGAGTAACAGTCGAGTCCTGTTCTGAGAG
AGTTCAGTCGCCATCGGTCCAGTCATGCTCAGGGCAATGTCTGATGCTGGGCATTTCCTG
GGGTAGACTTGAACTAAAAATTAAAAAGGTGGATGGAGAAAGAAAAATAAACAAAAAACA
ATCAGACTAATATAAATAAAGAAAGAAACAGTGGCAGGGAGGGGAAAAGTTTTCTAGCCA
GGTCCATGTTTAGAGGGCATGTGACTTAATCCTGCTCTGCTGAAGAGAAAATGAGCCTAG
TGAGTAGAGAGAGACCTCAGGTCCATCTCGCTCAAAGAAGGGGCACACCCCTTTGGGATC
GTGAGAGAGTCACATGACATCACCCTGTCTGTATGTAGTGAGGGGCTCTGCTGACACCCC
AAGGAGCATGACTGGAGAGCGACCCCATGATCAGATCAATGATGGCGACAAAGGCATCTT
CTGACTCCCCGTCATGATCAGAGGTGGAAATCTGAGGTCTGCCTCGACACTCATGGAGCG
TCTCTGTGCCGCGACCCTTTGAGCTCACCTCGTGCTCTCCCCTTTCCTCCTCAGCCCGGG
GGCAGAACCCGAATGAGTCGAGGGCCCTCCTGTGCTCATAGTTGTTGCCATGGCGTTCTC
CTGTGATGGACATGCCCTACCATGTGAGTAACACCCCTGTTCCATGCTCAGAGGGGTTGG
TGCTTGGCCGTCGTGCCTCCCTGTCACTTGACATGCTTTGTGAGAAGGACGCTATTGAGC
ATCAGGTTGGTTGAGGTGGCAGGCCGAGCTTTGTATGGCTTGAGGTCGGTGCTGATTGGC
TCACGTAGTGACAGGCAAGCGTGACTGGGGAAGGGATCCGATGGATCTGTGATGAGCTGT
GGATGCCAGATGAGTGAGTCCTCCATGACGGGTCAGTGTCTGAAAGTCTGAGATTCAGCC
TGACACCCATGGAGCCTTTCTTTGATGGCATTCTTTGAGCTGTTTTTCTGATTCTTATTT
AGTCTTCAGTCTTTGCTTTCTTTACCTGATTTAAAGAATCGTGCATATATTTACCTTTCT
CCCATGTTCGTATCTAGAGGTGTGTGGACACTGCTTTGAGTTTCATGAAAGTTGTTTTTG
TTTATTCATGTGCTGGAATTTACTCGTGTTTATTAAAAGGTGAGATCTGTAGTGAACGTT
GTTGTCAGTAGTGTTTGATGTCACTCCAGGTCTGTTTAGTGAAAATATTTCCTTTCATTC
TCACTGTCACTGTGGATATTTGTTAGAATTTGAGAAACTTGGTAAAATTCTTTCCTAATT
ATACTAATATATCTCCTTCCTCCTTAATTAGTCAAAAAGGCAACAGACCTATGCGTTTAA
AATCATGGTCTATTTGGCCATTCCCAGACTAGTTCTGAGAAGGATGGGTAGAGTCATGGA
TGATTAGTAATGATTAGTATATAAATGATTATTGCTCCACTGCCTTTTTTGTTTTCATTA
TAAGTTTTGGGTGGACTTTTTGATGAATTTAATATCTATGAATAGAAAACCATCATGGCT
TAATTAATTAGCCAGTGTGTAAATTAATAAAGACAGTGAAGTGAAAGTTTATGCATCACT
AGGCTCTCCATTCAGAAAATGTGGGAACCATCCACTGAACCAGGTACCGATTGGCCCCAA
GATATTGGTTTTTTTTACTCATGATAGTACAGGCAGAGCTGTAGACCTGGTCTTTTTTCT
TTATCTCTGCTCAACGTTACTTCTTTATTGTGTTGAGTCTGTAATAATCCTTCACATAAC
GAGATAATCAGCCCAGCAGTTACACATGTGATTTCAGATCAACGTGGAGGTGAGTGTCTT
CTTGTCACTATATCTGCTTTACAGCTGCGCCCAGTTGGTTTCTGCTTCTGCTGTGATGAA
AATACTGTTTTCTCTGCATCAGAAACAGTAACCAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved