Erinaceus_europaeus Locus Mono:260:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:260:SNORA26
Erinaceus_europaeus
Mono:260:SNORA26
scaffold_373183
SNORA26
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNGGCAATAGATGGCTATGGAAAGTTCACATCCTTTCA
TTTATTATAGCAGGGCATGGGACCTAGACCATGTTTATACAAAATTGCCCAGCAGCTCCC
CTTTATCCTTTGAAAGTGCATGCATAAAATTAAGTGTTCTCCTAATAGTATTCTCTAACG
TAGACTTTATAACAGATCTTAACTTCAACTTGATGGTGACTAATTGTTGAACTGCTCACA
ATTGAGATCAAACTTAAACCAAGATTAGGAGTATGTATAATAAATACCAATTACCTGAGC
ATTTGCTATATACCATGAACTATTGCTGACATAAAGTACTATTGGAGTAAAAGGTCCACA
ATGAGATAATTTTTACCTACTGTAGCATCCTCTTGAAACTCACAATGTACACAAACCTGT
TAATGTCTCTGAAAGGGCCTCACAGAAAATAACTTATGTGAAGTGACTAAGACCTTTTTA
TGAGGTATCTTTCGTCATGTGCAACTTGAGGTATGTTGCTATGTACCTCTGTTTCTAATG
TGTTGTCAGTGGTATCAAAATGCAAAGTCACGGGCAGTCCCTTAGAATTTCATAATCTAT
GGGAGAAGGAGCAGTAAAAGGATCTGTGGTTTTTGGCTATGTCTGAAGACTCAGTCATTT
CCCTGAAGGTGACAATTGAGGGAAATCTCTACACATTGCCAAGGTTTACCGAAAATTTAA
TAAGCTTCTAAAGGTGGAAACTATAAAGTGACTATATTTTGAAGATTGACCACTCTAAAA
CACAAGACAACTTAAAAAAAAAAAAAGAGTTCTTAAATAACTAGACTCTGTAAATGGTGC
ACAGAAGAAGCCAAACTAAAAACTTCTCCAATTTCTGCTTCCACTTCAGGGTATAATGCA
ATGACATGGGTGGTCAGATTTATTCCGCCACTTGCTAAGCCGTAGGACTTTAGGAAAGTC
ACTTTACTTCTCTGACTGTTTCCTCATCTGTAAAATGAAAATTATCCTTACCTAAAGACT
CACTGTTTAAGAAGCTAACACAGAAGGGTAAAGTAAGTCTCCATAAAACCCAGGGGAGAG
ATTACAGAACTCTTCTTTGGATCCTGTCTGGAGTTACAGTTTAAAATAAAAAAAGTCACT
GAGGGAGTTTGGCGGCAGTGCAGCAGTTTAAGCGCAAGTGACACAAAGTGCAAGGACCGG
TGTAAGGATCCCAGTTCGAGCCCCCGGCTCCCCACCTGTAAGGGAGTCACTTCACAGATG
GTGAAGCAGGTCTGTAGGTGTCTATCTTTCTCTCCCCCTCCTCTCTACATTTCTCTCTGT
ACAACAACAATGACATCAATAATAACAACAATAATAGCTACAACAATGAAAAACAAGGGC
AACCAAAGGGAAAATAATTTTTTTTAATTTTAAAAATAAAAAGTCACTGTGAAGATTAAA
AGAGGATGCACAGATAATTTTTCTGTTATAAACAGGAAGGATATATATATATACATATTA
GTTCCTTTCTCCACATCTTTCTCTTACTTTTTCCTCCAGTGTAGCACAGTTTTCAGCTTA
ATTGGTGTAGGAAGGACAGGAATTTTGCTGTTGATTTTGCAGTAGTCATTCTCCTCCAGA
GCTAGTTTTATTTAAGGAGCTCTCATGTCAGTGATACAAGGTCAAGAGCAAGGCACTGAA
ATTTCAGTTCAGCTAACTAAGACCCAACATACACTGGGGTATACCAAGATGAAAAGACAA
GTCTTGTCCTCAACTTGCTCATGACAGAGTGGTGAAGATACCTAGTGTGCTCAGTGTGGC
ATAAAATGGGAACTATTACCCGGGGCCAGAGAGAGGCAAATGAAACTAATGTAGAACACA
TGGTGACTGAGTGAAATCTGGGAGCCCAAGTGCACTCAGTGTCATCTTTATCTATCCAGA
AAAGTCAATTACTGACCTAATCCAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved