Erinaceus_europaeus Locus Mono:309:SNORD88
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:309:SNORD88
Erinaceus_europaeus
Mono:309:SNORD88
scaffold_313327
SNORD88
1001..1092
2092
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATTTTCAAAATCTCTT
TATCTTTAGGGCTTCATTTCATTTTATCAGGGCACTACTCAGCTTTGATTTATGGTGATG
CTGGGTGAACCTGGGACCTTTGGAACCTCAGGCGTGGAAGTCTTTTATATACCATTATGC
TGTCTCCCCTGCCCCAAAGTCTCCTTAGTTGATCAGTCTTTCCGCATAGTGCAAAACAAA
CAGAGAAACAAGCAACCCAACAGCAGCAAAACCACTAACATAGCCCAAGTTTTTAGGCAT
TAGTGTGAACTTCTTTGGCTATTTGCACTCAGGATATGCTAAAGTTAGTATTTTTCAGTT
TTCTTAACACACTGAGAAATGATGTGTTAAAACTAGCTATTTTGCCCCCGTGATGTCCAG
CACTGGGCTCTGACCACCCCTGAGGACATGGTGCCCCCCGGGACCTTTGACACCCCGGGG
GTCTGAGGGGCCCCGATCTGCAGAGGTGCATGTAGGGATGGAAGTTGCTGCCCTCGGAGT
CTGATGTTTCTCCCTCTCTCCGTTCAGCACCACCTGAGACCAGGCCTCACCGCGGTGCGG
CCATCACATTAAAGTCTCATCTCGGAAAAAAAAAAAAAAACTAGCTATTTTTTTAAAAAA
ATTTTCTTCACAAAGATGAGAGAAATATAGATTATTCCGAATTACTTTAAGATTTTTTTT
GAAAGCTATTATTTAAGCCTCTTACTATTATTCACAATAGATTATAAAGAAAAACCTTGA
TTTCAATATGAAAGAAAATAAAATGAAGCTTCTTCCTGACAAGAGTAAAGGGAGGGAGGA
TGGTATCTGGCAGTTCATTGCCTTGAGAAGATAAACTACAGAAGCAAAATTACCAAATTG
ATGTACATTACAATAAATAATTTAAATCCAGAGAACTCAGGAATATGACTAACTACTTGT
TGGGAAAAAAATTGAACACAAGAGTGTAAAGCTCATATTTTACCACTCTTAACTGATTGT
GAGTTGAAATGTTAATTTTTTATTTTCAAAGTAAAAATGCTAATTTTTCAAGTGTGTCAG
TGAAGTAAAACAGGAGGAAAAAGATGAAAATCTTTAGCAAAGACTCACTGTAGATAAAAA
AAAAATAGTCCTTTACCTCTGGTTGGGACTGGTATGTATACAAATGAAATATTTTGAATA
TCTAACTATTTTCTTCTTTTTGAGGTTGCTGTATATTATACTATCTCTGCTTGTCTTTGC
AGCTTTTCTTTGGTTACTGCAAAAATGATGGGCGAATTTCTGTAATAAATACAGAAGCAA
AAGAGGCATTCTTAAAGAGTACAGGGGTCATGCAGTTCACTCCATTCATAAAAATGCAGA
GCACAGGGAAATAGAAGAGAATTCAGATCTGACTTTTTTTTTAAAAGACAAATACTGAAT
GATTACTCTTGATAACTTCCCTTGCATGATCAGAAGATCTCTATAGCTAGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved