Erinaceus_europaeus Locus Poly:11:SNORD50
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:11:SNORD50
Erinaceus_europaeus
Poly:11:SNORD50
GeneScaffold_8617
SNORD50, SNORD50
1001..1071, 1244..1311
2311
GCGCGCACCACGCCCCGGAACGAGCCCGCGGAAGAAAAGAGACGCCGCGCGCGCCCTCG
CTCCCCTCTTTCCGGAAATAGTCACACCCCCATCTTCTCCCTTGTCCAATAGAAAGGACA
GGGAGGGGCTGCCTCGTTCTGACTCAAGGGAGGCTATATAAGGAACTGCTGGAAGGCTCC
ATCGGTCTTTTACATCCGGAGTTGGGAGTTCTGCGTTGATTTTGTGGTGAGCTTTACTAG
TGGGCTGAAACCTTTCTGGTCCAGGTTTGGCTGAGGTTGAGGTTGGGAATGCATGCTTAT
TAGGATTTTGGTTTTTTGAGCCTAGAGTTCTTTGATGGGGCCTGATGAAGTGCAGCTGGC
CTACCATGGTCCTCGCTGCCCTGCGACTACTGCTGATGGACACGGACTCACCGCGCTTCC
TAGTTGCTGAGCAGCAGCGAGTAAACACCACCCCACCCCTTAATTTAGGGGCTGGGAGTC
AGTTTCACGTTAAGGGAATAGACATTTTTGCACAGGGGAGGCCGCCAGAACAAAGGTGTT
TTTTTTTTTTTTTTAAGCGCATAGGCTCCGAGTCAGTTTTACCCAGGTGGCGCTGTTGGA
AAGTTGGATTACTGAAAGGGAAGGTTCTAAATATATTCTGTTCCCCACAGGGACAATGGC
TCATAATGCTATGACGAAGCTGTGGCTTGGAGATGCGAAGGTAAGTGCTGTTAAAAGCTT
GGGTTTTTAGTTGAAGTCATCCTGTTATGCAAATGAAGACGGTGCATCAGCTTAAGATGT
GTTTTTTTTTATTAGATGCAAGAGAAAATTATAAGCCATGTGGAAGGATACTTACTGGAG
AGACACTTGGTTAAAACTTGACAGTTTATTATCAGTGTCCTGCAGATTGATAAATACTAA
TGAAATTGTAGGCGCTGACAACCAACTTTTTTGAAGTAAGTTGCAGTCTTAATGTTTAAT
TACAGCCAATTTCATTGTAACATAGTTTAACGTAATGGCCCGATCGATGATGAGGCTTAC
CCCGAAGCTGATATCCTGAAGAAAAGAAAGTTACGGATTCGGCTTCTGAGATGAGACCAA
ACATGAGTTGTACTTGACTGTAGATTGTTCTATGGGATCTACCACTCACAACCTGTTTTC
TGCCTACAGTGAGGAGGTCTCTGCCCTTTGAAAGGCCAAGCTGCTACTGTGGAATCAGTG
TGAGTAGATTTTTTAAGCCGCTTTTAATACCCTGCTCTTGGTCTTATCTATGATGATCTT
ATCCCGAACCTGAATTTCTGTTGAGAAAACGTACGGATCTGGCTTCTGAGATAGACCATT
AGTGGGTATGTTACTTTTGAAAATGCTTTCAAACTGATGGTTTAGTAAATTTCAAATGTT
TTCTTTTTCTAGGGCTAGTACCTCGAGATATGCTTGTCCTGTGAGGGAAAGCATTACATT
TCACAAATGTGGGAAGAAAATGAACAGATCAAGACAAGCTTTGTTTTTGTTTTTTTTTTG
CTTTTTGGAAATGATGGTGAACTAGCAATCTGCATTTGGATCAATGTATTCAGAGATGCA
GGCCACTCCTGTTTAATATCACAATACCCAGACCCCTTTTGGTGTAACATGTTTTAAATG
TAAAGTGTAATTAAAGCTAAGTGGCATGAGATTCGGAATACCCTGACTTTATGCGTAAAT
CTTGATTACTAAGTATTTCTGGATTGGTGGGGGTAAGAAATACGCTAGGTACTAAGCCAC
ACAATGTTTAGCCCTTAAGGGAATGCCAGTTTTACTATTTGGTAGGGCAGAAATCCGGGA
GGGGAGGAGTGGCACACCTGGTTGTGCACACATTACAGTGTCCAAAGACTCAGGTCCAAG
CCCCTGGTTCCCACCAGCAGGGGGAGATCTTAACAAGTATTGAAGCAGGGCTGCAGGTGT
CTTTCTCTACCCCTCACAATTTTTTTTATATTTATTCCCTTTTGTTGCCCTTGTTTTATT
GTTGGATAGGACAGAGAGATGGGGAGAGAAAGGTAGACACCTGCAGACCAGCTTCACCTT
TTGTAAAGCAGCTTTCCTTCAGATGGGGAACGGGGTCTAGAACCAGGATCCTTAAGCTGG
TCTTTGCACTTTGCACCACTTTGTGCTTAACCAGCTACACTACAACCCAACTCCCATCCC
TCACAATTTCTGTATCCCACAGCAAATAGGGCCTGGCAGTGGCACACCTCGAATGTACAC
TACAGTGCACAAGGACCTGAGTTAAAGTCCATTATCTCCCCTCTCAATTTCTGTATCCAG
TAAATTTAAAAAGATAAACTAAAATTTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved