Erinaceus_europaeus Locus Mono:153:SNORA29
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:153:SNORA29
Erinaceus_europaeus
Mono:153:SNORA29
scaffold_269755
SNORA29
1001..1137
2137
ATCACTGTGTCAGTCTCTCCCCTCTAAGGAATGAGGCTAAGAGGGAAAATGCTCTTTTG
TAACTCAGGTCTACACTGATAGTACCTACTACGACTACACAGAAAGCTGCATCCCCTCCT
ATGTGTTTCATTCCCAGATAGAGAACAGAAGGGGCTCCTGGCTGGTAGGCTCACTCAGAG
TTCCATTGTATTCACCCAGTGTTCACCATCCTTTTATCCTTTGATCACACACATAAGCAT
ACTCCATCACAAGACTTGCCAGCACCCTAGCAGTGAGACCCCCACACCTATTTCCTTGTT
TTTGATATCTATGATTTACATCAAGCTTTGCCCTTCTCTGCTTTATCTCACCTTACTGGT
TTAACCACTATGTTTTTCTTAATACCTTTAGATAATTAACATGCCTTGTCTCATGGAAAC
TAATTGCTTTGACCTTTCTGTATCTCATCAATTCTTGTCATTCCTACCCCTCCCCACCAT
GGGGGTATCTGACCTTTAGAACCCTGTAATTTCTGACATATTTGAAAAATGTCCTTGGTT
CTGTTTGCTATAAAACCCTGTGCTTACCCCAAATAAAGTGGAAGTTCATACCTGAGTTTC
CCCTGGCAGTTTTCCTTCTGCATCACACAGTCCCTAGAACCAGTGACGGGAAAGCCAGTG
GCTTACCTCAGGTTGCAAGGCCACCCACATAAGCACCAGCACCCTTCCTCTCTGTCCTGT
GCACAAAAAAAAAAAAAAAGAAGTCACCAGGAGGAGTGCTGGCTTAACTAAGCCCAGTGA
TAACTATGGAGGCAAAAAAAAAATTATCTAGCCCAAAATGTCAATAGTCTAAAGTATGAG
GAGACAGCGCAGACAAGTATCATCAACTATTAGCATCACTCACTACCTAGTTCCTAATAA
AACCACCTGTGAATTATATTTGTCAAAATAACCAAATCTGAATTTGATGAAATTTCTAAC
TGCCAATTTATCAGAAACACCAGGGGAATAAAGCACATGCCTTTCCTGTTTGACCACCAC
ATTCTCTCCAAATCACAGACATTAGTGGCTCTGCTTGTGGGGTAGATTAGTCTTGTCATG
GTCTCATAGAGGACTGAACTGTGCCATCACCTCACATGGAGTGGTTCCAGCCAGAGGGTA
AGTCTCCAACCCTCCCTCACCGGCTCTTAGGGACCGCGTGGTTCAGAAAGGAGACACTGA
GGAGTATTCTGGTACAAAGACTCATTTATTTGGAGAAGGGTGCAGGTTTATATAGTTAAA
CAAAGAACATTTTTCACATTTGTCAGAAATTACAGGTTTATTAAAGGTCAGCTTGCCCCT
ATGGTAGGGGGCTGGTATGACAAGAATTAAAGCAATACATAAAGGTCAAGACAATTAGTC
TTCATGATGCAGGCAAGTTAATTATCCAAAGGCATTTGAGAGAAGCATAGGGGTTAAACC
AGTAGGGTGAGGTAGAGAAAAGGAAAAACAAAACTTGATGTAAACAGATATCAAGGAGCA
CAAGGAAATAGAAGTGGGGTTTTTTCACTGTCTGGTGTTGGGGAGGTTTATGATAGAGTG
TGTTGTCCTTTGTGATCAAAAAGTGAAGTGGATGTGTAAACTTTGAGTGAGCCCTAAAGC
AGGCAGCCATTTGGCCTACTGCTAGCAGAGGAAACTAAGTGTGAGAGGCCTGTAGGCTTT
CTGTGAGCTTGAGAGACTAACAAGGAGAAACTGAGTCTGGGAGACTTTTTCCTCTTGGCT
CATCTCTATAAGGAGAGAGGCTAACAAGTGGGGTGTCTTTCCAGACCTCCATCCAGGGAT
GGGAGAGCTCCCCTAAGCTCTACCAAGCTTTCACATAGTCCCACAGTCAGCCTTTATGTA
ATAGCACCCGGCAATGCATTGTGTCAGGACGGTGCTCTGGCTTCTCGCTCCTGTGACACT
GTTTCATATGAAATTAGTCTGTAAAAATGAAAACATGTAAACCACACTTCTGCTAGAGCA
GGTGACAGAGAACTAAATACAAGGATCATGAGCAAGTAATCAACTGCCCCCAAAGTAACG
CAGTGCTTTGCTCATGCACCTGGACTTTTTAAAAGCTAAGATTCATTTCTCGGGGACCAG
GTGGTGGCACACCTGGTTAAGCACTCACATCACAGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved