Erinaceus_europaeus Locus Mono:250:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:250:SNORA70
Erinaceus_europaeus
Mono:250:SNORA70
scaffold_332772
SNORA70
1001..1137
2137
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCCTCTCTGTCTCTCCCCTCCT
CTCTCCATTTCTCTCTGTCCTAGCCAACAATGACAACAACAACAACAAAACAACAAGGGC
ACCAAAAGGGAAAAATAAATACAAATTAAAAAATAATAAATAAGATCTTTGAAAAAAACA
TGTATCTGCAGGCTGGAAGGCAGATAAAGCACTGGACTCTACTGCAGCCAATGGAGCCGA
CCGTGCTGGGGCCTCCTCCCCGTGGCGCCCGGTGTGCAGCGGCTGCAAACAGCAGCCTCC
TGGGCAGTGTGCAGCCTGTTGCTTGTACAGGCTGCCCTAAGGGGCCCTGGAGACAGCCCT
TCCTGCTCGGTGTTCATTTTATGCCCGACCTCCTGCTGTCCCTAGTCTTAGGCTCCAGAC
GGGGATGCGAGGTGCTTTTGGGAAGCGCCAGGGCACTGTGGCCAGGTCATCATGTCCATC
TGCACCGAGCTGCGGAACAAAGAGCATATGATCGAGGCCCTGCGCAGGGCCAAGTTCAAG
TTCCCTGGACGCCAGAAGATCCCCAGTCCAAGAAGTGGGGCTTCACGTTTAACGCAGACG
AGTTTAAAGACATGGCGGACGAAAAGCGCCTCCTCCCAGACGGCTGTGGAGTCAAATCCA
TCCCCAGCCGTGGTCGGTCCCCTGGACAAGTGGCGGGCTCTGCACTCCTGAGAGCCTCAG
AGGAGTCCCTTAATCAGTGACAATAAATCAAGATCCTGCTTAAAGAAAAAAAACAACACT
GGATTCTTGAGAATACCGTCCTGAACTCTATTCCTGGCGCCACATGTGCGCCAGAGTGAT
GCTTTGGTTCTCTCTCTCTCTCTTTCCCAAGCACTGCTCAGCTGTGGCTCATGGTGCTGG
GGACTGAATCTAGGGCTTCAGAGACTCAGCCATGGGAGCCTCTGCATCTCCAGCATGCTT
GCTTAGCCCCCCCCCCGTAAAATAAATCTTTAAAGAGTTATGTATCTCGGAAGCTGGGCA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved