Erinaceus_europaeus Locus Mono:78:SNORA68
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:78:SNORA68
Erinaceus_europaeus
Mono:78:SNORA68
scaffold_275131
SNORA68
1001..1132
2132
TGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATA
GCAGACTGGTTATGCAGTAGACTTTCATGCCTGAGGCCCTATGGTCCCAGGTTCAATCTC
TATGATCCTGGGGGACAGAGGGGGGTATGGGGGGGGAGGGGAGGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTTTGTCTCTTTCATGCCTGAGGCCCTATGGTCCCTGGGGGGA
GGGTGTGTGTGTGTGGTGTGTGTTGTGTATGTCTCTTTCATGCCTGAGGCCCTATGGTCA
GTGTGTGTGTGTTCATATCTCTCATTAAAATAAACAAATAATTAGCACCTAAACCCAAGG
GCCACTATTTATTGTAATAGTGGTTCAAACACAGGTGCTAACAGCAAAGGGTACCTCGTC
ACCTTTGGAGGACTTGCTATGCCCTTCAAAGTGAACTTAGAGGTTCTACACACCTCCTGG
GATTGTATTAAGTAGATCAGCAGTGGAAATTGAGGACTGTGGCCCACACTATCCACCCAC
AGACTCCCACCTCCTACACGGGGCATTTGGAAGTAATCAGCATTATATCATCGTTGGATA
GGACAGAAATGGAGAGAGGAGGGGAAGATGGAGAGAAAGATAGGGTACATGCATGCAAAG
CGCAAGGACCAGCGTAAGGATCCCGGTTGAGCCCCTGGCTCCCCACCTGCAGGTGAGTTG
CTTCACAAGTGGTGAAGCAGGTATGCAGGTGTCTATCTTTCTCTCCCCCTCTCTGTCTTC
CCCTCCTCTCTCCATTTCTCTCTGTCCTATCCAACAACAATGACATCAATAATAACTACA
ACAATAAAACAACAAGGGCAACAAAAGTGAATAAATAAAAATTTTTTAAAATTCTCACAA
TCTTTTCCCTTAAAACACAATGACAGATACCCTCCTCCTGATTTAAGAGGATGAACTAAA
CTCTAGCACGAGCACCACTTGAGAAATCAAACAGGAGTCTGAGAAGATAAAGGTTATTAT
TATCCTGAGGAAAGTCAAATAACTAAGTAGGAAAAAGTGTGTTAAAGGTGTGTGAGAGGT
TGGAAGGGGGAAGAGTGGTTACTGTTGCTTGAGCTTCATCACTCCAGACTGACAGAAAGA
GAAACATAGATGAAAAAACAGAGGAAAAGGCAAAGACACTACACCGAAGCTTCCCCTAAA
GTGGTAGGGACTGGGGGTTGGGCAGTAGCACAGCGGGTTAAACACATGTGGCGCAAAGCA
CAAGGACCATGTAAGGATCCTGGTTCGAGCCCCTGGCTCCCCACCTGCAGGGGAGTCGCT
TCACAGGTGGTGAAGCAGGTCTGCAGGTGTCTTATCTTTCTCTCCCCCTCTCTGTCTTCC
ACCTTCTCTCTGTCCTATCCAATAACGAACGACATCAACAACAACAATAATTACAACAAG
GGCAACCAAGGGGGGGAAAATGGCCTCCAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved