Erinaceus_europaeus Locus Mono:422:SNORA41
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:422:SNORA41
Erinaceus_europaeus
Mono:422:SNORA41
GeneScaffold_436
SNORA41
1001..1126
2126
GAATAGAAACTGGAGATTAGAATGGTAAAATAGGAAGAGATAGTAAAGTTATAAAGAAC
ATATTGTCTTGTTGTTCAAAATGGAGAGAGGGAGTTTAGATGTTCCTTCAGATGTATATA
TAATAAGCAAAGGAGAGAAAAAATAATCTACAGTTTTGCATTTTTAGCACAAGGATAAAT
AAAACGGGTTCGGGAGGTATATTTTGTGGGGGTGAGGGGGGTGCGAGAGGGGGTCAGATC
ATGAATTTGAGGTTTCTAAGGGATATCCAGATTGAAGTTTTTACCAGAAATCTGAAAGTA
AATCTTTGAAACTGAGTAGAATAATCTGAGCAGAAGATAGAAATTTGAGTGTAAACATAA
AGAAGATAGTTCAGCCTAGCAGGGACTGTGGGTTACTTATAGGTGGAAATAAATCCAGAG
TGGTAGTGTGTGATTTCATAGGAGAAAAGATAGTTTTCTTTCTTTTTTCAAATTTTTATA
TTTATTTATTTATTTATTCCCTTTTGTTGTCCTTGTTGTTTTAGTGTTGTAGTTATTATT
GATGTCGTTGTTGTTGGATAGGACAGAGAAATGGAGAGAGGCGGGAAAGACAGAGAGGGG
GAGAGAAAGACACCTGCAGACCCGCTTCACTGCCTGTGAAGCGACTCCCCTGCAGGTGGG
GAGCCGGGGGCTCGAACCAGGATCCTTACGCCAGTCCTTGCGCTTTGCACCACCTGTGCT
TAACCCGCTGCTCTACCACCCGACTCCCAGAGGTCAGTTTTCTTTCTATTGCTGGCAATA
ATGAAGTAATATATTAAACAAATACATTCTTGTCGATAATTGACAGAAATGGAAAAGTAG
CGAATACAGTCACAAATGGGTTATATTCCAGTGGCAAAATCATTTCCCTGTGAGATCTAG
CAGTGGGAGTGGTATATCAAGATAAGAGTTCTCTTGTGAAAGTTGAGAAGACTACATTTT
TATACTAGCCATAAATATATAGACATTTAAATTGAGTCACATCCCACAACTACTGGTCTG
CAACTCTTCTTGTAGCCATTGTGGCATTCGTCTGTGGAAAATAAACTGCTACACAATGTA
AATGCCCCATTAGCAAAATAGAAAGTGGACATGTGTGAGACAAACAAGGTGCTTAAAAAC
AATTATGTCACCTCAGTCGAAAATGAAGCCCAGTGAAATGTTAGATTTAGAGGGATAGTA
TCTACTTAAAGTCATGGAGTGGAAATGGTGTTCTTGGGCACAGCCTTAATTTTAATTAAA
GAAAGAAAGTAGGCGTGTGGCCTGGGGGAGGGCACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved