Erinaceus_europaeus Locus Mono:288:SNORA62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:288:SNORA62
Erinaceus_europaeus
Mono:288:SNORA62
scaffold_361979
SNORA62
1001..1141
2141
GTGCTAACATAGAGAGGATGTGGGGCCCATGTAGGCAGGGGAGATTGACAGGGGGCCTA
AACCTGGAAAGTCAAGGCCCTCCTTGCTCGACCCCGAGGTGGGGGAGACTGATGAGGTGG
CTGTACTTTCAGGCACCCGTTTTTCCATAGGTGGTCCACAGTGTGCTCAACCTCAGCCTC
ACAATTCCCCACATCTGTTCCCAGAGTTGAAACATCACACTTTTTTTTTTTCATCTTTAA
AAAGCTTAAGCATGGTACATTGCTTCAGGAAAAATCAAAACTTTTTCATTCAGGTTATTT
ATGAACATGGATTCCTAGCTGTGCCAGTAACTAATGCATCCTGATGCAATTAAAAGTGAA
GATGTAAATTCATTTCACAGACTTGTACACATAGTCTTTAGAAATCATGTTTTGAAATGT
ATCCTCATATAACCTTGACCATTTTTTTTATTAGGCTGTTATTATTTGGGGAGTTCCTTT
GACTCACTGCTGCTTATTTCTAATGAGGCTCTCTCATGCTTATGAAACCTTGCCTGATAG
GGAATTTTATGAAGTCTCTGTTCTTGAAAGTAGCTCCATGTCTATCTGAAAAATCGTTCC
AAATCTCAGTATGCCTAAAGAGGAAGTACCTCCAGTATGGTCAGCTTATAGATCCAAAAG
TAATGCAAGTATGTGTAGGAAAAGAATCTGTTATTCACAGACAAGGTAAGAGGTCATTTC
AGCTTAGCATGTTCTCTATGAAGAATGACTATATGTCTCCTCATACTTTGGAGACAAAAA
TACTGGCAGCCCATCAGAGTGACTAGGTGGGAAGGGCAGCATTTGGAGATCATCTCTGCA
TAGAATTGTGGGACTTGCAGGGATTGGCCAGTTTTGTCTCTACTCATAGTATGGTGTAGA
TTATCCTTGATGCCTACGTTAAAGGGCATCAGGCTTCGTTTCTCATAATTAGTCTAAATT
AAAGATTTTTCTCTGCATAAAGTATTTTCTCTATCTGTTTTTACATTGTTAGAGCTTAGC
ATTGAGGCCCCTGACTAGCTGATGAACTCAGTAATATAGATATACATTACACCAGGGGCA
AGGTCTTGGCTAACACTGTATGTTTCAATGAATTGAGTTTGATAATACTCCTTGCTACAA
TAGACTATTCATATATAAGCTTTTTAAAAAATTTTTTGTTATCTTTTATTTTTATTGGAT
AGAGACAGCCAGAAATTGAGAGGAAGGGGAGATAGAGATAGAGAGGGAAAGAGACAGACA
CATGAAGCCCTGCATCACCACTCGTGAAGCTTTCCCTCTGCAGGTGGGGACCAGGGACTC
GAACCCAGATCCTTGTTCATTGTAACATGTGTGCTCAACCAGGTGCACCACCACCTGGTC
CCCATGTGTAAGCTTTTTAGGAGTGATAAAAACATTTGATAAATTTAAAAAAAAATTGCT
TCAGTCTGTCTATAGAAAAATAATTGAGAGATTCATTTGGATTACAGATATTAAAAAAAA
AAAAATCCTGGAGCTGGTAGATGGTGCACCCCATAGAACATATATCTTCCATGTGATGGG
CCTTGGGTGTGAGGCCAAGTAGTAAGTTCAAAGAAACTATATACCAGAAAACATAATTAA
ACCGTCGTCATTCTTGAATACAAAAGAAATAATTCAAGTGTAAGAGATCTTCATCAGAAC
ACATGGGAAACCAGAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved