Erinaceus_europaeus Locus Mono:460:SNORA12
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:460:SNORA12
Erinaceus_europaeus
Mono:460:SNORA12
GeneScaffold_1934
SNORA12
1001..1155
2155
TGTTGTTGGATAGGATAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGGGGGAGAG
AAAGATAGACACCTGCAGACCTGCTTCACCACCTGTGAAGCGACTCCCCTGCAGATGGGG
GAGCCAGAAGCTTTGAACCGGTATCCTTTACGCCAGTCTTTGCCCGACAACTGAGTAGCA
TTCAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATATTTTTGTTT
CCTTTGGGTAAATCCCTAGGAGAGACCATTCTCGGGCATAGGGTAAGTCCATTTCTAGTG
TTGTGAGAAATCTCCAGACTGTTTTCCATAAAGGTTAGACCAATTTTTATTCCCACCAGC
AGCGCAGAAGTGTTCCCTTTTTTCCCACATCCTCTCCAACATTTGTTGTTGCTGTCCTTT
CTAATGTATGGCATTCTTGCAAGTGTAAGGTAGTATATCATTGTCTTTATCTGTATTGTG
TCTGTTGGCCCTTTGGATCTCTTCCTTAGTGAATGAAGTTTTTGTCTATATCCTCATTCC
ATTTTCTAATGGATTTTTTTTGATGCTGCACTTACTGAGCTTTTAATGTAATCATTTATC
TATGGAATATTGTATAAAAATCTCCCACACTGTATGGTGTCTTTCTCTTAGGACAGTGGT
ATCCTTTGCTGTGCAGAAGCTTTTCAGTTTGATGTAGTCTCATTGATTTATTTTTGTTTA
CTTTGCTGTTGAATTTATATCTTTGAAGACATTTTTAAAGCATAGATCATGAAATGTTCT
GCCACTGTTTTCTTTTATGTATTTTATTCTTTCTGATCTAATGTCCATATCTTTAATCTA
CTCCAAGTTGGCTTTTGTGTACAGTGCTATGTGGTGCTTCAATTTCATTCATTTCATGTT
TCAAAATGGCAGGCTACAAAGTCAATATACAAAAATCAGTAGCTTGTGGTAGTTCTCCTC
CTGGCACATTTGTTAAGTTTTCAGATGGGCTTGACTCTATCGCATACATTATTTAGGAGC
TGGCAAAGGCTTGATGACAAAGAGATCCCTCATCTCTCTCTTGCCTTCCCCTTATCAGAC
ATTGGCTCCTACAGAATAGAAAGAAAAAAGTAGAAAAAAAATCAGTAACATTCCTCTGTG
CCAACACTAAACTAGAAGAAGAAGTCTTCCAGAATCCAGAAATCACCTCCTTTTACTATA
GCAGAAAAAAACAATCAAATATTTAGTAATAAAGTTAACAAAAGAAGTGAAAGACTTATA
TAATGAAAACTGAGAGTCACCCTTTAAGCAAACACAAAGAGATACAAAGAAATGTGCAGG
GAGCCAGCTTCTGGTGAAAGTAATTAAGGGTCCCTGAAGGAAAGGAGGAGTTGGCGAGAT
GAATGAAGTGAGAGACACATTGGCTGTTTCAGGTGCAGGAGAGAGGCGTCTCTGTTCTCT
GTCTGAAGAGGTTTATTATTTAAACACTTTTTGCCCAGATACAGTTGACATTACGTAAGA
TTATTTTCATTAACATCAAGGATACAGATGATATCATGTATAATTGTTTTCATTAACATC
AGGAATAACCTTAAACAACATTATTATTATTATAGGTATGTTTTCCTTAGAAAGTTCCCT
AGGTCTGGGGCATCCTGATCTCCCCTTGAAAGTTTCTTGGGTCTGGGATAGCCTAAATCT
ACCCTTGAAAGTTTCCTGGGTCTGGGGTAATCTAAATCTACCCTTGAAATTTCCCTCTGT
GTTTTGACCATCTCCCTGTTCTGACCTTCTGTCTGAATAAACATTTTTCTTTAGAGGTTA
AATCTAATAGCTTTTCTTCTTAACCCATTCTTAGATGGATCTAACTAGGTCATAGTAGGC
TGTTCACCTAAAGAAATATTCTGCTGTAAAGTAAGCACACACCATGGGGGCTCTCTTCTG
GTTAACCTTTGCATATATGAAAGTTCACAAACTTTTAGCTAATGAAAGTTTACTTACTTC
TACCCATATATCCTAACATTAGGTATTTAACTACACAACCTAATACTCATCATGGATGTC
TGTAAGTGGAAGCAGGGTGTTTGTGGGTGAGGGTAAGCAATAGAGCCTTTTATAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved