Erinaceus_europaeus Locus Mono:312:SNORA36
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:312:SNORA36
Erinaceus_europaeus
Mono:312:SNORA36
scaffold_219477
SNORA36
1001..1134
2134
AATTTCTTGCCTTTTATCCTTTTTTAATTTCACTTCTTTCCTCCATCCAATGTTGACAA
ATATATAAACATACATGAAACTTATGGTAGTGTTTTTCAGGATTTGTAAAAAGAAAAAAA
AAAAAAAAGGAGGGAGTCGGGCGGTAGCGCAGTGGGTTAAGCGCACGTGACGCAAAGTGC
AAGGACCGGCATAAGGATCCCAGTTCGAGCCCCAGGCTCCCTCCCCACCTGCAGGGGAGT
CACTTCACAGCGGTGAAGTAGGTCTGCAAGTGTCTTTCTCTCCCCCTCTCTGTCTTCCCC
TCCACTCTCCATTTCTCTGTCCTATCAAAAACAATGATGACATCAATAACAACAACAATG
ATAATCACAACAATAAAACAAGGGCAACAAAAGGGAGTAAGTAGAAAAAATATTTAAAAA
AAAATAGAATCTTATTTCTAAAAACACTGCCTTTCACACTTAAAACCTATGATGAAAAGT
CTGTGCTATAATTTATATGCCCTAACTGATAGGCTGTTCTTTTCCCTGTCCCACCCCACC
CCCCAAAAGTTTTTACAGTAATTGACATTTGTGTAAATTCTTGCTTGCTTACTGATGCAT
GCATGCATGTGTGCCTGCCTGCCTACCTGCCTTTCTTTGCTTTACGGGTATTGCGAGGAA
TTGGTGCTTACAGCACCAGTAGGCCTGATCAGTGACTCACATGGTAGTGAACACAATGTC
ATTCAAAAGGACCCAGGTTCAAGTCCCCAGTCCCCAAATATAGGTAGGAAGCTTCATGAG
CAGTGGAGCAGTGCTCTTCTCCCTCTTTCTCCTTCCTTTCCTCCCTACCCTCCTCCCTCT
CTTCCGAAATATCTCCCTCTCCCTCTGTTTTCTCACTCTCCATCAAGAAGAATGATGGAG
AAAAGGTTCTTGGTGAGGGTCCAAATAATTTTACTCATGGCACCATCTCCTGGGCTATTA
AGTAAGTAGTTAAATATTAAAAGTAAAAATAACTAAAACATTCCCATAGTGTTGAGTTAG
GTTCAGGGCAGCTTCCCTGTTCCGTTAATTAAGCTTTGGAACACTGAAATACAGGCTAAG
GAGGATGACTGGGTAGAAAACGCTAGTTTACCCAAGTACTTCTCCATCTACAACAACAAC
AAAAAATGTAATAACTGAAATAAAACAGAAAGTCAAGCTGTTTTTCATTGCCTAAGTACA
GTTGGAGACCTTCTGCATTGCCTATTATTTTCAATGAAATAAACAATTATTCTCTAGAAA
AGAAAGAAAACATGATTTGTTGTAGATATATTTTTTAAAAAGGTTAACCACCAAAAGAAC
AATAGCTTCTACAGAGAACATTAAGATTCAAAATTGAAAACTACTGCAGTAATCCTGTCA
TAATGTTGATACTCAGAAAAAGCAAATCTGAAAACATCTATAACATCAATTTTTGAAGTT
AACTAATCACTTTATAAACATTAAAAAAAAATTATTATCCGTGGTCTGGGAGGTGGCGCA
GTGGATAAGGCTTTGGACTCTCAAGCATGAGATCCCGACTTCCATCCCCAGCAGCACATG
TGCCAGAGTGATGTCTGGTTGTTTCTCTATCATTTCTCATGAATAAATAAATAACTTAAA
AAAAACCCTAAAAAATGCATTATACTTATTTATTTATTAGAGACAGCCAGAAACTGAAAG
GCAGGGAGAGAGACAGAGATCTGAAGCCCTGCTTCACCACTAACAAAGCTTTCCCCCAGC
AGGTGGGGAGCAGGGGCTTGAACCTGGGCCCTTGCCCGGAGTACCATGTGCACTCTCACC
CAGGTGAGCCACCATCCAGCTCCTTAACACTTTAGAGCTACTATGAACAAACAAAAATGG
AAATTTCAAATAAACTTAAACATTAGATAGTTTTACTCCCAGAGTGACTAGTTTTAAAGC
TGGCTTTAAGATTTATAAGTATTGGGAGTCGGGCTGTAGCGCAGTGGGTTAAGCGCAGGT
GGCGCAAAGCACAAGGACCGGCATAAGGATCCCGGTTCGAACCCCGGCTCCCCACCTTCA
GGGGAGTCGCTTCACAGGTGGTGAAGCAGGTCTGCAGATGTCTATCTTTCTCTCCTCCTC
TCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved