Erinaceus_europaeus Locus Mono:95:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:95:SNORA70
Erinaceus_europaeus
Mono:95:SNORA70
scaffold_322235
SNORA70
1001..1134
1638
CGTCTTCTGGGCATTGTAGGATGTTTGGTAACATCCCTGGCTCTATCCTTAATGCCATA
TCTTAAATTCACTATTTGTCTGTAGGAACTGCCAAAGGGTTACTTGGGATGTATAGCTAC
CCTCCCCCCAGTTGAAAGCCACTGGAAAGACCAAAAGACTATATTCCTGACTGCCAAGAA
CTCTGACAGCTGCTCAAACCTTGGCTATACGGAACTGGTTAGACACTGACTATAGCCTGG
TTTTATTTGTTTATATAAAGCACTGATAGCCCTTAAGAATTCCTACATCTCTGCATATCT
TAAGACTGAAACTACATAAATCAGAAGCGAAAATCTGTTTCTTTAGAAACTTGAGTGCTT
AGATTTCAACTGTGATATTCAACTAATGAAAAATTCCTTTACAAAAACCACGGTCATCAG
TTTTGACCAAAAGACTAAAAGTAGTAACTTAAAATGAAAAATGAGAAAGCAGAAATGGGA
TGTATTCAATTAGAAGCAATTTGATCTGCCGCCAATTAAGCCGACCGTGCTGCCCTCCCC
CTGGCGCCCGGTGTGCAGTGGCTGCAAACAGCAGCCTCCTGGGTAGTGTGTGAGGCCTGT
AGCTTGTACAGGCTGCCCTAAGGGACCCTGGAGACAGCCCTTCCTGCTCTGTGTTCATCT
TATGCCTGACCTCCTGCTGTCCCTAACCTTAGGCTCCAGACAGGGATGTGAGATGCTTTG
GGGAAGCCCCAGGGCACCGCCCCCAGAGAACACATTGGCCAGGTCATCATGTCCATCCGC
ACCAAGCTGCAGAACAAAGAGCATGTATCGAGGCCCTGCGCAGGGCCAAGTTCAAATTCC
CTGGACGCCAGAAGATCCACATCTCCAAGAAGTGGGGCTTCACCAAGTTTAACGCAGATG
AGTTTGAAAACATGGTGGCTGAAAAGCGCCTCATTCCAGACTGCTGTGGAGTCAAATACA
TCCCCAACCACGGTCCCCTGGACACGTGGTGGCCCTTCACTTCTGAGAGCCTCAGAGGTG
TCCCTTAATCAATGACAATAAATCAAGATCCTGATTATCTTTAAAAGAAAAAAAAAAATC
TGAGAGAACTTTAACTGTCACTGTGTCACCAAAGCTAATGTGTAGCTTTGCTACATCTGA
AAAAGCACAGCAGAAGACACCATAAATAGTAGTAAAGCTTAGATTTAAGGAAACATGATC
TTAGTAGAACATGGCTGGATTTGTTTAGTAGTTTATTGTGCCATTAGAAAACTGTATTAT
GAAAGTACCAACAAGAATCAACAGATGTTCTATTTGTTTATTTTACAATCAGTATGCCAT
TTTTTAAACCATTATGGCTTTAAATTTTCATTCTGCCCAACAGGTTTCAAAGAATAGTTT
ATTACATGCCTTCAGAAAACATTTAAAATATTTACAAATTCAAAATAGATGTTCAATAAC
AGAAAACAAGTTCACCTGAGAATTCATAACAACATTGCCATTTGATTTTTTTTTTTCCAA
GTTGTTACTGTGGGTGAAAGTCCACAAGTGTCGTCTACTGCGTCAACTGTATTTCATTCC
TTCTTTAAAACTGCTTAGGCTTTAAGCTGCGGAAAATGATGCCATACAATTTACAGGGGA
AACCCAAGATTTCTGTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved