Erinaceus_europaeus Locus Mono:381:SNORA16
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:381:SNORA16
Erinaceus_europaeus
Mono:381:SNORA16
scaffold_213696
SNORA16
1001..1135
2135
ATAATGGTTATGCTAACAGATTCTCATGCCTGAGGCTCCAAAGTCCCAGGTTCAGTCCC
TTGCACCTGAATAAGCCAGAGATGAGCCGTGCTCTGGTTAAAAAAAAAAAAAGAAAAAGA
AAAAAAAGAAAGAAAGAAAGAGAAAAACAATAACAATTCACTGTAAAAAAATTAAAGAAA
GTGTTCCGGGAGGTGGCACAATGGATAAACCACTGAATTCTCAAGCATGAGGTCCCAAGT
TCAATCCCCAACAGTACATGTACCAAAGTGATGTCTGGTTCTTTCTCTATCCTCCTATCT
TTCTCAAATAAATAAATAAAATCTTTAAACAAAAATGAAAGAAATAGAATCGTTAAATTA
AGTCATAGTGATTAATTTAGCAGAGATATTTAGAACATATATAATGTATATGTTATGTAT
ATATATATATATATATATTCTTCGCAAGTGCACATAGAACATTTTCTTTTTTAAATATTT
TATTTAGTTAGTTTTGGTAGAGACTGAGAGAAGAGGGAAGATGGAGATAAACAGTGTAAG
AAAGAGACAACTGCAGAAATATTTCACTGCTCCTGAAGTTTTTCCTATGGCAAGTGATGG
CTTGAACGCAGGTTTTTGCACACTGTACTATGTGCCGTCAACATTGGTGCGTCACCATCC
GGCCCTGACCCTGGAACCTTTATATTGGGACACAAAAACAGCCTTAACAACTATGTAACT
ACTGAAATCACAAAAAGTATATTTTCTGATCACATGGGTGTGAAGCTAGAAATCAATCAA
AACAAGAGGCCACCTGACCCATGAAGTAGCTCTTGGTGCTGTGGCTGGGTGCAGTTGGCT
TAATTTATTTTGCATTTCATTAAGTATATTCTAACTTCATTCTTTCCATGTGAACGCAGG
ACTTCCACTTTGTGCTCCTGCTTGACCTCATGGAGCTTAGAAGATAAACACTATTTCATT
CTTTTAGTAAGTAGTTCACTTTTGTGTTTAAGACTTTACAGAGTGGCCCTTATCAAAGCT
GCAGCTGCTTCCATTTACCTGCTGTGGTCAAATAGGAGCCCAAAGTGTCATTTTTCCTTG
ATGGTCGCTGTTCTGTTTGTTATAACAGTTTTGCAACATTTTAGGAAAAGACAATTTCTG
TTGTATCTGCCTTTTTTTTTTTTTTTTTAACCAGAGCACTGCTCAGCTCTGGCTTATGGT
GGTGCAGGGGGTTGAACCTGAGACTTCGAACCTCGGGCATGAGAGTTATGCTATCTACTA
CTGCCTTTGATCCGATCAAGCCTTTAGTAGAAATGGTCTTTTTTGGTCTTGTGCGGTTAT
TAGAATTAAGGTTTTTTGTTTGTTTGTTTGTTTGTTTTTTACTGGATGTAGGTGGTGGAC
CACCAGGTATATCACACCTTGCCATGTGCAAGCACGTGGGTTCAAGTCCATTTTCTCCTA
CTTGTAAAAGGGAGACTAATATAGTATATCAGTGTGTAGGGCTTAGATAAGCCTTTTATT
CTGAAGACTAAAGAAAGTGACAATTACATTTTCAATTGGGCCAGATGAAATTTCAGACTT
CAGATGCTCCTTTGAGGATACGTCCGTGGTGTTATGGAACAGAGCTGTCTTGGGACTTGG
TTTCCTGGCAGTGTCAATACTGAAGATTGTGAGAGACCAGTTGCTGGAGTTTTGCTTTTT
AGAAAGATCTGTTACCAGTAAAGCTATCTCCATCTGCTTCTAGTATGTACTCTGCAATAC
AGAAAAGAAGAATCAAAAGGAACTAAGCTGAGACAAGGAAAAGTGGCAGGGACTATAATG
GCCATAGCCTTGAGGTTTGAAGATTGATCCCAAACATCCCCTGGTGTTAATAAAAAGTTT
TTTTTTAAAAAAAGGCTTTACAGGAAGAGGGCAGGGGTAGATAGCATAATGATTATGCAA
ACAGACTTTCATGCCTGAGGCTCCAAACTCCCAGGTTTAATTCCCTGCATCACCATAAAC
CAGAGCTGAATAGTGCTCTAGTGGGGGAAAAAAAAAGAAAAAAAGACTTTTTCGGGATGA
TAGTAAGAAATATTAGATAATCTACTATACTTGAGTATTTATTATTTGTCTTTTCACTTA
GGAAAATAGATGCTTTGACAGTTAAGACTACAGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved