Erinaceus_europaeus Locus Mono:133:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:133:SNORA70
Erinaceus_europaeus
Mono:133:SNORA70
scaffold_222189
SNORA70
1001..1117
2117
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGTGAAGCAGGTCTGCAGGTGTCTTT
CTTTTCTTCGGCCCTTCTGTCTTCCCCTCCTCTTCTCCATTCTCTCTGTCGTATCCAAAT
AACAACCACATCAATTAACAACAACAATAATACCTACAACAACCAATAAAAAAGACAACA
AGGGCAACAAAAGGGAAAATAATTAAAAAGAAAAGAATAAAAAATAAAAAAGAAAGAAGA
TGGTACCCGGTGTGCAGTGGCTGCAAACAGCAGCCTCCTGGGTAGTGTGTGCAGCCTGTT
GCTTGTACAGGCTGCCCTAAGGGACCCTGGAGACAGCCCTTCCTGCGCTGTGTTCATTTT
ATGCCTGACCTCCTGTTGTCCCTAACCTTAGGCTCCAGACAGGGACTCAAGGTGCTTTTG
GGAAGCCCCAGGGCACCATGGCCAGAGCCCACATTGGCCAGGTCATCATGTCCATCCGTA
CCAAGCTGCAGAACAAAGAGCATGTGATCGAGGCCCTGCGCAGGGCCAAGTTCAAGGTCC
CTGGACGCCAGAAGATCCACATCTCCAAGAAGTGGGGCTTCACCAAGTTTAATGCAGATG
AGTTTGAAGACATGGTGGCTGAAAAGCGCCTCATCCCAGACAGCTGTGGAGCCAAATACA
TCCCCAACTGTGGTCCCCTGGACAAGTGGCTGGCCCTGCACTCCTAAGAGCCTCAGAGGT
GTCCCTTAGTTAATTATAATAAATCAAGATCCTGCTTATAAAAAAAAAAGAAAGAAGTGG
TCCGGGAGGTGGCTCAGTGCCTAAAGCATCGGACTCTCAAGCATGAGGTCCTGAGTTCAA
CTCCCAGCAGCACATATACCAGGGTGATGCCTGTTTCTTTCTCTCTCCTTCAATGTTTCT
CATTAATAAATAAATAAAATATTTAAAAAAGAAAAAAAAAAGAAAGAAGATGAAGGTGTG
TTGGTGGTATACAGGTGAGCATAGTTGCTCTCAAAGGAAAAAAAAAACATAAAAATGAAA
CATCCCACAGTTTACTCTTTAATAACAATGGGGAGATCTGGTTGACAATACCTTAATCAA
ATTATGTAAATGTTCATCACTGATAACAGACAAACTGACTGATGTGTCTCGTAGTGTGAT
GTCCTGGTGCCGGGGTTATCCATTTCTATGAGATATAAAAGGCGAAAGATTTGTGCCATC
TGAAGAGAAACCAGAGTATCTGTGAGATATAAACAATCCCAGCAATTAGTTACTTAAAAC
AACTGAGAGCACCTTAAATTGAACACAAGTGGGGGCTGGGTTGTAGTGGAGCAGGTTGAG
TGCATATGGCGCGAAGCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved