Erinaceus_europaeus Locus Mono:47:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:47:SNORA73
Erinaceus_europaeus
Mono:47:SNORA73
scaffold_319441
SNORA73
1001..1200
1663
CTAGCCCTCTGGGAGCATGGACCCAGGGTCGTTGAGGGTTGCAGATCGTTGAAGGTCTG
GCTTCTGTAATTGTTTCCCCGCTGAACATGGGCGTTGACTGGTTGGTCCATACTCCCAGT
CTGTCTCTCTCTTTCCCTAGTAAGGTGTGTCTCTGGGGAAGCTGAGCTCCAGGACACATT
GGTGGGGTCTTCAATCCAGGGAAGCCTGGCCAGCATCCTGGTGGCATCTGGAACCTGGTG
ATTGAAAAGAGAGTTAACATACGAAGCCAAACAATTTGTTGAGCAAAAAAATTATTTTAA
AAAAAGAAAATATCAACAAAACTATAGTATAAAGGGTAAAATTCCACACATTTCCCACCA
CTAGAGTTCTGCATCCCATCCCCTCCATTGAAAGTTTCCCTGTTCTTTATCTCTCTGGGA
ATATGGACCCAGGATCATTATAGGGTATAGAAGGTAGAAGGTTGCCGACGCGGATACCCT
GGGGTCGCTCTCCCAGGCTCTGTCCGGGTGGCGGCGGGAGCGCAGGGCTCTGCCCCATGA
CGTACAGTCCCTTTCCACGGCGTCGGAGATGAAGCCGGGCCCTGAGTCCACGCCTGCATA
TTCCTACAGCTTCTCAGAGTCCCACGGGCCGTGACTGAGGAGACAAACCATGCAGGAAAC
AGTTTACCTGAAAACCCTGCCTGGGTGGAGGCTGGTTTTTTTCTTTCCGCCCTCATCAGT
CTCTGTGATTTAAGCTCTTTGCATTGTTTTTGCAGAAAAAAAAAAAAAAAAAAAAAAGAA
GGTAGAAGGTCTGGCTTCTGTAATTGCTTCTCCACTGAACATGAGCATTGGCAGGTTGAT
CCATACTCCCAGCCTGTCCCTGTCTTTCCCTAGTGGGGCAGGGCTCTGGGGAGGTGGGGT
TCCAGGGTCCACTGGTGAGGTCGTCTGTCCAGGCGAGTCAGGGTGACGTCATGGTAGCAT
CTGCAACTTGGTGTTTGGAACATGTATTCCTTTGCTTCCTCCTTTCCTGTGGGACTCAGT
TCAGTAGTCCTTTTTTTTTTTTTTTCCTCCATGGTTATTGCTGGGCTCGGTGCCTGCACC
ATGAATCCACCGCTCCTGGAGGCCATTTTTTCCCCCTTTTGTTGCCCTTGTTGTTGTAGC
CTCGTTGTGGTTATTATTATTGCCATTGTTGATGTTGTTCGTTGTTGGATAGGACAGAGA
GAAATGGAGAGAGGAGGGGAAGACAGAGAGGGGGAGAGAAAGATAGACACCTGCAGACCC
ACTTCACTGCCTGTGAAGCGACTCCCCTGCAGGTAGGGAGCCGGGGGCTCGAACCGGGAT
CCTTATGCCAGTCCCTGCACTTTGTGCCACATGCACTTAACCCACTGCGCCACCGCCCGA
TCCCCTCAGTAGTTCTTTTAAGTGGGCTTGATTGGGGCAAATTCCTTTAGTTCTTCAATA
TTTGAGAACGTTTATTTCTCCCTCATATTTGAAGGATAATCTTGCAGGATACAAGTCATG
GGTGGAATTCTCTCTCCTTTAGAACTTTGAATATGTCATTCTACTCTCTCCTTGCCTCTA
GAGTTTGTGAAGAAAAATCTGACGACAGCGTTACAGCTGTGCCTTTGTATGTAACTTCTT
CGCTTCCCCTAGAGCCCAGCAAATTTTTCTTTTCCTTGTCATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved