Erinaceus_europaeus Locus Mono:184:SNORD90
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:184:SNORD90
Erinaceus_europaeus
Mono:184:SNORD90
scaffold_367784
SNORD90
1001..1111
2111
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCTTACCAACCCCTGTGTT
CCCTCCTTCACTTATTCATTTTTACCTGGGGGGCCTTACCCCTTCAGTCGATTAGTCAAC
TGAGTGGTTTGGCCACCGGGGCAATATTCCTTTGCCTACTCCTTCGATTTTCTTTCTCGG
TCCCTCTTTCTTCTTTTCTTGTTCCTGGACGTTAACGCTCCCCTCCCCCCGGAGCTTTTT
CCTTTGGCGTATACACCAACCTCTATCTCCTTCATTCTTTTTAATATTGAAAATAAGTTC
TTCCTAGCGCGGGCATAGTGGATAAGCTGTCTGAAAGCATGAGGTACTGGGATCCTTACG
TGCTAGCGTGATCCCCTGCCTCCCGTGTTCTGGAGTGATGCTCTGGTGTCCTTCACCCCC
CTCCATCTCTTTGTCTCTCCCTCATCGTTAATACATCTGTAAAAAAATAATTTAAGTGAT
GTAACAAGGAAGTAAATATAAAGGGTACTAGCTTAAGAGTAGCCTGCCTTACAAAGTGTG
TCATTTATCTTCATTCTGATCCCAGAGATTTATGAGTTTATAAATTAGATTTTTAAGTGT
CTAATGATGAATTTCATAGGGCAGATTCTGAGATGAAAATTAAATTCATCACTGATACTT
CTACTGTGAAATCTGAAGACACTTGAAAAACTCTTTAGTATGCTGACTAAATTTTAAAAA
ATGTGTATACATGTGTTATAAGAACTAAAGACTATTCTGTTATCTGTTTGTTAGCTTCAG
TCTCCGGAATCATTTGCAAAGAGTGTCCAGGAATTGACAATTGTTTTACAACGGACAGGT
GACCCAGCTAACTTAAACAGACTGAGGCCTCATTTAGAGCTTCTTGCAAATATAGACCCT
AACCCAGGTATGTGTGAAATGCTCAGTTGCTACTTTTTCTAGCGCTTGAGATAAATGATA
CAAAATAATTACTGCTAACAAATTCTCCCTCTTCCACCCCTGGTCCCCCATCTTGTTTTT
TCATGGTGGTGGCTCCTTGTAGATGCTGTTTCACCAACTTGGGAGCAGCTAGAAAATGCG
ATGGTGGCTGTTAAAACAGTAGTTCATGGCCTTGTGGATTTCATACAGATTATAGTAGAA
AGCATGAGACACCTCAGTAGCATGCTTCTGCACTTCTGATCACTAGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved