Erinaceus_europaeus Locus Mono:428:SNORD99
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:428:SNORD99
Erinaceus_europaeus
Mono:428:SNORD99
GeneScaffold_3058
SNORD99
1001..1080
2080
CTGTGTAAGTACAAGAAGGGTCAACATAGCTTCTGCTCTATAAGAGAGAGTGGGGAGAT
ACTGAGCAAGTGCATGGTTGCTGCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGGTCCATTAACCTCCATCCCAATGAAAGTGACTAAAAAAAAAAAAAAAGACC
TACTTTAGTGCTTAAAAAAAAGCAACTATAAAATTATATGTATTTCTAGGTGGTCGGGCG
GTAGTGCAGCAGGTTAAGCACACGTGGTATAAAGTGCAAGGACCGGTGGAAGGATCCTGG
TTCGAGCCCCCGGCTCCCCACCTGCAGAGGAGTCGCTTCACAGACGGTGAAGCAGGTCTG
CAGGTGTCTATCTTTCTCTCCCACCTCTGTCTTCCCTGCCTCCCTCCATATCTCTCTGTC
CTATCCAACAACGAATGACATCAACAACAACAATAACCACAACAAGGCTACAACAAGGGC
AACAAAAGGGGGGAAAATAGCCTCCAGGAGCAGTGGATTCATGGTACAGACACTGAGTCC
CAGCAATAACCCTGGAGGCAAAAAAAAAATATATATGTATTTCTGAAGGGAAAGGAATGG
GGAGGCATTTATTAGTGGGTACAAAAGTTTCTGTTTGGGTGATGGAAATATTTTAGTAAC
AGAGTAGTGATGACTATATTCAGTGCAGCTGAGTATACACTTAAAAGCTTAAAAAGAATG
GTCTGGGATGTGGCACAGTGGATAAAGTGTTGAACTCTCAAGTGTGAGGTCCTGAGTTCA
ATCCCTGGCAGCACATATTACCAGAGTGATATCTGGTTCTTTCTCTGCCTACCATTCTTC
ACAAATACATAAAATCATTTTTAAAAAAGATTAAAATGACATTATATTACATGTGTTCCA
CCACAAGAAAAAGATGAAGCAAGTAAGCCAAAAGGAAAAAAATTGGTCAAGGATGAAAAC
CTATCTCTGTGGACATCATTGGGTGATAAATGTGGATATGGGACTGAGACCAGTTCTTGG
GAAATACAAGTGACATCTACTGATTTGGACAATACTAACACTGGTGTATATACTCTCTTT
TTAGGAGAATCAAGAGGAAGCAAGCAGAGACAAGGAAAAGTGGCAGGGGCTACAATGGCC
ATAGTCTTGAGGTTTGAAGATTGATCCCAAGCATCCCATCTTTCTCTGGTGTTGATCAAA
ATAAAATATTTTTTAAAAAAGTTAAAAAACAAACAAAGAAAAAAGATTATATGTATATCT
TCCTTACTTACCAGGATTGGACAACCCAAAAGATGCTTAGTAAAATTTAGTCTACTATAA
GGACCTGGTGGTGGTTCACCTAGAGAGTGCATATGTTACCATGCACGAAAACCAAGTTTA
AGTCCCAGGTCACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved