Erinaceus_europaeus Locus Mono:324:SNORD22
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:324:SNORD22
Erinaceus_europaeus
Mono:324:SNORD22
scaffold_297187
SNORD22
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAGATATTTTCTTACCA
CAAATTTCTTATAAAATTGTTTTAATCTTTTAAAATATTATTTTCCCTTTTGTTGCCCTT
GTGTTTTTCATGTTGTGTAGTATATGTTGTTGTGTGATGTCATGTTGTTAGGGCAGAGAG
AAATGGAGAGAGGAGGGAAAGACAGAGAGGAGGAGAGAAAGATAGACACCTGCAGACCTG
CTTCACCGCTTGTGAAGGGACTCCTCTTCAGGTAGAGTGCTGGGGGCTCGAACCGGAATC
CTTATGCGGTCCTTGTGCTTTGTGCCACGTGAGCTTAACCCGCTGTGCTACTGCCTGACT
CCCTAAAATTTTTTATAAAATATTATTGAAGTTATTTAAACTTCTCTGGGACATAAAACT
GTCATTTTATGGGGCCGGGTGGTGGCACACCTGGTTGAGTGCACATGTTACAATGTGCAA
GGACCTGGGTTCTAGTCCCCTGTCCCCACCTACAGGAGAAAGCTTTGTGAGTGGTGAAGC
AGTGTTGCAGGTGTCACTGTCTCTCTCCCTCTCTATCATCGTCTTCCCTCTCGATTTCTG
GCTGCCTCTATTCAATAAATAAATAAAGATAAGAAAAAAATACCTGGTGAAGAAACACTC
AAATATCTTACCTCCTGTCCTAGTCCCAGAGCCTGCAGAAGTGAACCTACTGGGACTGGC
TGGGGGAAAAAAGAGGACTTTTGTTCCAGCAGGAACTGTCTGAGGGATTAACTGTACCCT
ACTGAGTACATAAAAAGCAGTGATTCCCATCTAATAAGAACTTCACTGTCTCTATACAGG
AATTCCAGCCTTGTAGGACACAGCTTTATCCAGCCTGTCTGTATTGATCAGCTCTCAATT
CTAAATAAAAGTCTATTTAACATTTAAAAAAATAAAAAAAACAAAACTTTCATTTTGGTA
TTTCTGATAATTTTGCATCAGGGTGATGGTGCTGGGGGAATAAGAGGAAAAGTCAACAGT
TTTCCTAAAAAGGAAGAGTCCCTAGAATGGAAGGATACTTTTCCATAAAGGAAGACCCAC
TAAGGGACTGGGTGGTGGCACACCTGGTTGAGCGCACACATTACAAGATAGAAGGATCTG
GGTTCAAGTATGCAGTCCCCACCTGCACAGGGGAAGCTTCATGAGCCATGAAGTAGTTCT
GCAGGTATCTTGCTCTCTTGCTCTCTATCTCTTCCTTTGCTCCTAATTTCTTTCTGTCTT
ACCAAAAAAAAAAAATAAAAATAACACACTGACAGGTGCCCTCACACAATTTAAAAAGCC
ATAACTTAAAAGAGTGCTGATGCTCAGTCTGTTCTCAAACCTACATGTCTCTTCCATACA
AAAGAATTCCTTCTGCTTGACTTGCTGCCTTTCTTTTTCCTTTTTTGCATTAAGAATCTG
GGCTTCCTCTTAAAATGCAAATACCTCTAGGAAGGTTATACAATCATTGCCAAGTAAGAA
AAGCTTTCACCAGATTGTTTCCAGCAAATTTAAGGCTTATAATGCATATTATAAAATATA
TTATTATATATAATATATAAATAAAGAGAGATGGTATATGTTACGTATAAATATAATTTA
TGTTATATATATTACATAATGTATGCCCATGAAGGGTGGCATTTTTGAGCCTTGAGTGGA
ACGGTGCAAAGAGTACCGAGGTACATGCAGACAGTATGGAATAACAATAGTCTCTTTTTT
TTTTTTTTTGGAATTTTGCCGAAAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved