Erinaceus_europaeus Locus Mono:131:SNORD100
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:131:SNORD100
Erinaceus_europaeus
Mono:131:SNORD100
scaffold_342647
SNORD100
1001..1076
2076
ACAACATACTCTATGTTCTACCTGAGGAAGATGGGTCCTGAAATTGGGGCAGCTTGGAA
CATTCCTACTCATGACCACAGAATGTCATAACTTTTTGGGATGTGTTGCAATGCTTTCCA
TAGAGTAAGGACTCCAAACAAACTGAACTAGTAGGAAACAAATGTGAACATATAAGTAGA
GAGACAGATACATGGCAGGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAC
AGGTAGACAGACAGACAGATAGTTGATAGATTTAAGAGATCCCCCAACATGGGAGTGTAT
GATCTAATTTACTCAGTCTACTTATTCAAATGCTATTTTTTTTCTAAGAACATTCTTACA
GACAAACCTAGAACAAATGTTTGAACAACTATGTAAGACATCTTGTGACCTACTCAAGTT
GCATAAAATTAACTTTTTATGTTAAAAAAAAAGAAAAAGAAAAATAAGGGGGGGGGAGAG
AAAGATAGACATATGGAAGTAAAGATAGAGCCAAACTTTCTCTAGGACTTTGTGAGAACT
GTGGGGGTTATCATAAGATGTTGGGAGAAGACAGACAAACCATTATCAAATAACTAATTA
AAAAACTAAGCTAGTGAATCACAATACTTTTTTTTTTTCTTTTCAACACCAGATCCAAAC
ATAGTCTGCATTCCTACAGCAGAAGCAAAATTGTAAAATATCAGGGTAGGTAACATTCCT
TCTTTCTTACTGATGATTCTCTGTGTTCTGGTCTTCCTCCCCAAAATTCTTACTATTTCT
TAGTCAGTAGGAAAAATCAGTATGTAGAAATATAGCTTCCTTCTTCCTGAATACTGACAC
TTTCATGCAATTTTATCTCTAAGTTAGGTCATGGATTTAAAAGGAATAATATTGCATAAC
TTTATTTATTTATTTTTTGTAAAACCTATTAACAAATAAAGAAACCAAGATCTATTTGTA
AGGGCATTATTACAAGTACCAACTCCATCACAATCATTAGCACTGTACATGATGACAACT
GGCTCCTTCTACTGAACTGTCATGAGGAAAATGCCAAAAAAAAAAAAAAAAATCAGCAGC
ACTTACAATGATGATGATGGTGTTGACCTCTACTCTGGAGCCTAGATTTAAAGTAGTTAT
GTTACAAAGTTCTATATTGAGAAAACCTGTTTTCCTTCCTTGAGGAGAAAAATAAAGCTC
TTTAGAAGTAATTCCATCAGATTATGCTGTCTGGTAGTAGTACTATGTGAAGTAATCTAT
AGTGCTCTTGAATTGTCTCTGTGAAGGGAAAGTTTTAGCACCTGGTCACTCTTGTTCTTG
ATGATGCAAACATCTATTGAAATGACCAATGCTGCAATTGAGTGTCTCAGTTTTTTATTG
CTTCTGTTTAAGCTCAGTTTACCTCTTTATAGCCTTGCTTATTTTTTTTCATAGCACAAA
TTAGATCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved