Erinaceus_europaeus Locus Mono:105:SNORD14
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:105:SNORD14
Erinaceus_europaeus
Mono:105:SNORD14
scaffold_330548
SNORD14
1001..1082
2082
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGTGCTCACATCACAGTGCGCAAGAACCCAGGTTCAAGCCCCTGGTCCC
CACCTTCAGTGGGAGAAGCAGGGCTGTAAGTCTCTCTCCCTCTTCTCTCAATTTCTCTTT
GTGTCTATTCAATAATGAATAAATAAATAATAATAAAAAGAAAGGATTAAGCCTTTCAGT
CAGGAACTGTTTTTCGTTTCGTTTGTTTGGAGAGCATAATGGTTATGCCAGAGGCTCCAA
AGTCCCAGGTCCATTCCCCAACACCACCATAAACCAGATCTGAGTGGTGTTCTGGTTTTA
AAAAAAAGGAGGGTGGGGGGCACAGCTGGCATACCTGGTTGAGCACATATGTTACCTGCA
AGGGGGAGGGAGCTTCACTAGCGGCGAAGCAGTGCTGTAGGTGTCTCTTTAGCTCAACCT
CCCTCTTAATTTATCTCTGTCCTAGTACATAAAATAAAAGACAAACAAACAAAAAAGGGT
GGTTCAGAAGACAGTGCTTGCCATGCATACCAAAGCAGCCAGGTTCAGTCCATTATGTGG
TGCGCCAGTCTCTCATGAAATAAGATTTTAAATTAAAAAATAATAATAATAAAAATCACC
AATAAAAAATTAATTACGGGGACGAGTGTTGGTGCACCTGGTTGAGTGCACATGTTACAG
TGCATAAGGACCCAAGTTCAAGCCCCCAGTCCCCATCCGTAGGGTGAAAGCTTTGCCTGC
AGTGAAGCTGGGCTACAGGTATCTTTGTTTCTTTCCCTCTCTATTTCCCCCTCCCCTCTC
AATTTCTGGCTGTCTCTATCCAATAAATAAACACACTAATTAAAAAATTAATTACACATA
AAAATAAGATTTAAATATTATAGGATCAATCAGATACAACTTCACAATGATGAGTGGCCC
AACACGTGCAGTTGACACCAGAATTTCAGATGTTGGCAACTACCTCCTTGGATGCATGAG
TGATTCGATTTCATGAATTTTCAAATTAATGTAACGGGCTTCTGTGTGTTTTTTTGTAAT
AGGCTTGTCCCATCACTTATTTGATAATGTGCACCTAACCAGGTGTGCCACCAACCCCTT
CAACTTATCTGAACTGCCTTTGGTAATAAAAGTATTTTTCTCTCCCCCCCGGGGGGGGGG
AACAAATCAAGCATTAGGGGTCAGATAGTGAGCACACATATTATAGTGCCAAAGGATGTT
GATTCAAGCCCTCCATGCCCAACTGCTGGGGGAAGCTTCATGTGCGGTGAAGCAGTGCTG
CAGGTCTCCCTCTATACCTCCCCACTCCCCTTCAATTTCTCTTTCAAAAAAAAAAAAAAT
ATATATATATATATATATACATATGATTGCAAATCAAGCATTACTCTTTTATTTTAAATA
TTTACTTATTCTTTTGTTGCCCTTGTAGTTATTATTATTGTTGTTACTGATGTCATTGTT
GGATAGAACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGGGGGAGAGAAAGACAG
ACACCTACAGACCTGCTTCACTGCTTTTGAAGTGACTCCCCTGCAGGTGGGGAGCTGGGG
GCTCGAACCGGGATCCTTACGCCAGTCCTTGCGCTTTGTACCACATGAGCTTAACCCACT
GAGCTACCGCCCGACTCCCTAATATCTTTTTTTTTTTTTTTTAGAATTTATTTATTTATT
CATGAGAAAGATAGGAGGAGAGAAAGAACCAGACATCACTCTGGTACATGTGCTGCCAGG
GATCGAACTCAGGACCTCATGGTTGAAAATCCAATGCTTTGTCCACTGTGCCACCTCCCA
GACCACCCTAATATCTTTTAAAAAATATTTATTCATTTATTCCCTTTTGTTGCCCTTTTT
CTATTGTAGTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved